ID: 1133997820

View in Genome Browser
Species Human (GRCh38)
Location 16:10761774-10761796
Sequence CCGCGCCCCCGGTTGTGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133997820_1133997826 -8 Left 1133997820 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1133997826 16:10761789-10761811 GGGCGCGGAGCTCATGTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 89
1133997820_1133997828 1 Left 1133997820 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1133997828 16:10761798-10761820 GCTCATGTGCCAGGACTTGGAGG 0: 1
1: 0
2: 0
3: 24
4: 202
1133997820_1133997830 14 Left 1133997820 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1133997830 16:10761811-10761833 GACTTGGAGGTCCCTCTCCTCGG 0: 1
1: 0
2: 1
3: 19
4: 152
1133997820_1133997833 28 Left 1133997820 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1133997833 16:10761825-10761847 TCTCCTCGGCAGAGTGCCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 149
1133997820_1133997827 -2 Left 1133997820 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1133997827 16:10761795-10761817 GGAGCTCATGTGCCAGGACTTGG 0: 1
1: 0
2: 0
3: 24
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133997820 Original CRISPR CCGCGCCCCCGGTTGTGGGA GGG (reversed) Exonic
900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG + Intronic
900585923 1:3432300-3432322 CTGCGCCCCAGCTTGCGGGAGGG - Intronic
901132937 1:6973882-6973904 CCCCTTCCCCGGCTGTGGGAAGG - Intronic
903138696 1:21325990-21326012 CGGAGCTCCCGGCTGTGGGAAGG + Intronic
904602243 1:31680000-31680022 CCTCTCCCCCAGTTGGGGGAAGG + Intronic
909698438 1:78492580-78492602 CCCAGCACCCGGTGGTGGGATGG - Intronic
1062890553 10:1056718-1056740 CGGCGCCGCCGGGTGTGGGGCGG + Intronic
1069438531 10:68407301-68407323 CAGCGCCCCCGGCGGCGGGAGGG + Intergenic
1076507658 10:130988351-130988373 CCTCACCCCCAGTTGTGGGCCGG + Intergenic
1081831463 11:46119877-46119899 CCGCGCCCCCGCCGGGGGGAGGG - Intronic
1082787657 11:57325622-57325644 CCACTCCCCCGGCTGCGGGAAGG + Intergenic
1083293462 11:61702638-61702660 CTGGGCCCCCGGTTGGGAGAGGG + Intronic
1085455333 11:76662208-76662230 CCGGGCCCCTGGAGGTGGGAAGG + Intronic
1095962342 12:47843672-47843694 CCGCACCCCAGAGTGTGGGAAGG - Exonic
1096024811 12:48351101-48351123 CCGCGCCCGCCGCTGTGGGGAGG + Intronic
1101735622 12:107460746-107460768 CCCAGCCCCCTGATGTGGGATGG - Intronic
1102052373 12:109872077-109872099 CCGCCCACCCGGTCCTGGGATGG - Intronic
1111951205 13:94711116-94711138 CCGGGCCCCCGGTCGCGGGAGGG + Exonic
1124345546 15:28919334-28919356 CCCCGCCCGCGGTTGTTGAACGG + Intronic
1129862364 15:78872723-78872745 CCCCCCCCCCGGGTGGGGGAGGG - Intronic
1133997820 16:10761774-10761796 CCGCGCCCCCGGTTGTGGGAGGG - Exonic
1139469495 16:67170611-67170633 CCCCACTCCCGGCTGTGGGAGGG + Intronic
1142141481 16:88474566-88474588 CCCCGCCCCCCGAAGTGGGACGG - Intronic
1143108049 17:4539185-4539207 CCCCACCCCCGGTTCTGGGCTGG - Intronic
1143482914 17:7237880-7237902 CCGGGCCTCCGGTTGGGGGAAGG - Intronic
1153457227 18:5295274-5295296 CCCCGCCCCCGGCCGCGGGAGGG - Intronic
1160740526 19:683438-683460 CCGCCCCCACGGCTGTGGGATGG + Intergenic
1164634414 19:29781917-29781939 CCGAGCACCAGGATGTGGGAAGG + Intergenic
1165081535 19:33309901-33309923 CCAAGCCCCAGGATGTGGGAAGG - Intergenic
1167529564 19:50006892-50006914 CCGCTCACCCAGGTGTGGGATGG - Intronic
925347263 2:3179800-3179822 CCGTGCCCCCTGTGTTGGGAAGG - Intergenic
931429168 2:62195983-62196005 CCGCGCCCCAAGTTTTGGGAGGG - Intergenic
1173858771 20:46268538-46268560 CCGAGCCCGGGGTGGTGGGAGGG - Intronic
1180842895 22:18967553-18967575 CCGAGCCCCAGGTTGGGGGTGGG + Intergenic
1181105403 22:20571667-20571689 CAGCGCCCCCTGCTGGGGGATGG + Intronic
1181514995 22:23405227-23405249 CCGAGCCCCAGGTTGGGGGTGGG - Intergenic
1182289809 22:29268509-29268531 CGGCCCGCCCGGTTGGGGGAGGG - Intronic
1182604113 22:31489930-31489952 CCGCGCGCCCGGATGTGAGGTGG + Intronic
1184532432 22:45064790-45064812 CCCAGCCCCAGGTGGTGGGAAGG - Intergenic
961340577 3:126214264-126214286 CCTCGCCCCCTGCTGTGGTAAGG + Intergenic
961548134 3:127650443-127650465 CCGCGCCCCCTGTGATGGGTTGG - Intronic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
1002696947 5:181098266-181098288 CCTCGCCCGCGGCTGGGGGAAGG + Intergenic
1002697675 5:181101107-181101129 CCTCGCCCGCGGCTGGGGGAAGG - Intergenic
1005987789 6:30884880-30884902 CCCCGCCCCCGGTTTTCAGACGG - Intronic
1015605448 6:134950719-134950741 CTGTGGCCCCGGTTTTGGGATGG - Intergenic
1019208011 6:170378788-170378810 CCGAGCTTCCGGTTGTGGGCAGG + Intronic
1021998561 7:26202367-26202389 CCGCGCTCCCGGGTGGGGGCGGG + Intronic
1026613172 7:71878924-71878946 CCCTGACCCAGGTTGTGGGAAGG - Intronic
1031899423 7:127392813-127392835 CGGCGCCCCCGCCTGTGGGTAGG + Intronic
1036454261 8:8893591-8893613 CCGCGTCCCCGGCGCTGGGAGGG + Exonic
1039554754 8:38467948-38467970 CGGCGCCCCCGGATCTGGGGCGG - Intronic
1042039441 8:64577107-64577129 CAGCGCCCCTGGTTCTGGGCTGG - Intergenic
1049361525 8:142214385-142214407 CCGCCACCCCGGATTTGGGATGG + Intronic
1059004154 9:110383542-110383564 CCGTGACCCCTGTTGTGGGGGGG + Intronic
1059161309 9:112037852-112037874 CTGTGCCCCAGTTTGTGGGAGGG - Intergenic
1189534614 X:41923539-41923561 CCGCCCGCCCGGGAGTGGGAGGG + Intergenic