ID: 1133999099

View in Genome Browser
Species Human (GRCh38)
Location 16:10768814-10768836
Sequence CTCCATCTATAGATGGTCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133999093_1133999099 23 Left 1133999093 16:10768768-10768790 CCTAGAAGAATGATGTCAAGGGT 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1133999099 16:10768814-10768836 CTCCATCTATAGATGGTCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133999099 Original CRISPR CTCCATCTATAGATGGTCCG AGG Exonic
900954331 1:5877374-5877396 CTCCCTATATAGGTGGTCCTGGG - Intronic
1064414317 10:15135682-15135704 ATCCATCTACAAATGGTCCCCGG + Intronic
1071561720 10:86650846-86650868 CACTATCCATAGATGCTCCGAGG + Intergenic
1076495504 10:130894826-130894848 TTCCATCTCTTGATGGTCCAGGG + Intergenic
1078488908 11:11751197-11751219 CTCCATCCATGGAAGGACCGTGG - Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1092296335 12:7202127-7202149 CTGCAGCTAGAGATGGTCAGGGG + Intronic
1094074654 12:26459470-26459492 CTCCATCAATAGATTGTTCTTGG + Intronic
1100867775 12:98875637-98875659 CTCTATCTATAAATGGTGGGAGG + Intronic
1112308168 13:98294023-98294045 GTCCATCTATGAATGGTCTGTGG + Intronic
1118981113 14:70717839-70717861 CTCCATCTACAGGTGTCCCGTGG + Intergenic
1122049895 14:99049329-99049351 CTCTATCAATAGATGGTGTGAGG - Intergenic
1122355685 14:101121727-101121749 CACCATTTGTAGCTGGTCCGGGG + Intergenic
1126460833 15:48913460-48913482 CTCCATCTAGAAATGGACTGGGG - Intronic
1130024625 15:80260610-80260632 TTCCATCCCTAGATGGGCCGAGG + Intergenic
1133999099 16:10768814-10768836 CTCCATCTATAGATGGTCCGAGG + Exonic
1138372462 16:56538087-56538109 CTCCTTCCACAGATGGTCTGTGG + Intergenic
1149994103 17:61397774-61397796 GTCCATCCATAGCTGGTCCAGGG - Intergenic
1167429188 19:49444549-49444571 CTCCATCTACTGATGATCCTAGG + Intergenic
930846739 2:55914175-55914197 CTCTATCTATACATGGCCCCAGG + Intronic
937905665 2:127051628-127051650 CTGCACCTATAGATAGTCCATGG + Intronic
943065430 2:183081158-183081180 CTCCATTTTTAAATGGTTCGAGG - Intronic
944853271 2:203742249-203742271 TTCCATCTATAAATGGTTGGGGG - Intergenic
955093855 3:55777413-55777435 TTCTATCTAGAGATGGTCTGAGG - Intronic
967355087 3:188560207-188560229 CCCCTTCTGTAGATGGTCCAGGG + Intronic
967720862 3:192814964-192814986 CTCCATTTTTAGATGGTTGGGGG - Intronic
977317971 4:95475082-95475104 CTCCATCTATGAGTGGTCCTAGG + Intronic
986010979 5:3715045-3715067 CTCCATTTTTAGAAGGTCCCTGG - Intergenic
987181308 5:15371438-15371460 TTTCATCTAGAGATGGTCCAAGG - Intergenic
992316168 5:75557471-75557493 CTCCATTTAAAGATGCTCCTTGG + Intronic
992905957 5:81345931-81345953 CTCCAACTGTAGATGGTCCCCGG + Exonic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
994630257 5:102276454-102276476 CTCTTTCTATAGTTGGTCAGAGG + Intronic
1004340149 6:14801179-14801201 CTCCAGTTATGGATGGTCCCAGG + Intergenic
1005588158 6:27297183-27297205 CTCCATCAATTCATTGTCCGCGG - Intronic
1015551603 6:134418041-134418063 CTCAATCAATACATGTTCCGCGG + Intergenic
1018857847 6:167688273-167688295 CTCCATCCACAGATGATCTGGGG - Intergenic
1020260602 7:6528781-6528803 CTCCAGGTCTCGATGGTCCGGGG + Intronic
1030167547 7:106570325-106570347 CTTCATCTACAGGTGGTCTGAGG + Intergenic
1036646211 8:10612570-10612592 CTCCATCTATGCATAGGCCGGGG + Exonic
1041618079 8:59931604-59931626 CACCATCTACAGAGGGTCCTGGG - Intergenic
1043473676 8:80585367-80585389 CTCCATCTCTAAATGCTCCATGG - Intergenic
1044550731 8:93509619-93509641 CTCCATCTTGAGAAGGTCTGAGG + Intergenic
1186263015 X:7801244-7801266 CTTCTTCTATAGAAGGTCAGTGG - Intergenic
1202371940 Y:24204893-24204915 CTCCATCTCTTGACAGTCCGTGG - Intergenic
1202498845 Y:25465223-25465245 CTCCATCTCTTGACAGTCCGTGG + Intergenic