ID: 1133999928

View in Genome Browser
Species Human (GRCh38)
Location 16:10775050-10775072
Sequence TGGCACTCACTCGGAAAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133999925_1133999928 3 Left 1133999925 16:10775024-10775046 CCAGTCGCAGCTCACGTAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG 0: 1
1: 0
2: 1
3: 6
4: 76
1133999923_1133999928 22 Left 1133999923 16:10775005-10775027 CCACAAAGCTCTTGCTGAACCAG 0: 1
1: 0
2: 3
3: 12
4: 184
Right 1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG 0: 1
1: 0
2: 1
3: 6
4: 76
1133999922_1133999928 23 Left 1133999922 16:10775004-10775026 CCCACAAAGCTCTTGCTGAACCA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG 0: 1
1: 0
2: 1
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133999928 Original CRISPR TGGCACTCACTCGGAAAAAC AGG Exonic
908205411 1:61843061-61843083 TGGCACTCACTGGGAAAGCCTGG - Intronic
909481385 1:76131533-76131555 TGCCACCGACTCAGAAAAACGGG + Intronic
912152120 1:106872624-106872646 AGGAACTCACTCAGAAAACCAGG + Intergenic
914883947 1:151569853-151569875 TGGCACTCAGCCAGAAAGACAGG - Intronic
914982205 1:152424705-152424727 TAGCACTCACATGGAAAGACTGG - Intergenic
916246045 1:162689271-162689293 TGGCACTTTCTTGGAAACACAGG - Intronic
921569981 1:216766124-216766146 GTGCACTCACATGGAAAAACTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063227216 10:4026940-4026962 TGGCCCTCGCTGGGAAAGACGGG + Intergenic
1066638131 10:37527630-37527652 TGGCACTCAGTAGGAAAACTAGG + Intergenic
1071309750 10:84331258-84331280 TTGCACTCCCTCTGAAAAACTGG - Intronic
1071423186 10:85522570-85522592 TGGCAGTTACTGGGAAAAAAGGG - Intergenic
1076270465 10:129148034-129148056 TGGCACTGAATCGAAAAGACAGG - Intergenic
1076695729 10:132246437-132246459 TGGCACTCACTGGGCAAGCCTGG + Intronic
1077707131 11:4497574-4497596 TGGGTCTCTCTCGGAAAATCAGG - Intergenic
1079796565 11:24811148-24811170 TGGCAGTCAATAAGAAAAACTGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1087047074 11:93851096-93851118 TGGCAGTCACTCAAATAAACCGG + Intergenic
1088634684 11:111808453-111808475 TTGAACTCACTCAGAACAACTGG + Intronic
1091211586 11:133865225-133865247 TGACACGCACTCGGAGAAGCAGG - Intergenic
1091594722 12:1869544-1869566 TGGAACTCAAGAGGAAAAACAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1103899654 12:124296589-124296611 TGGCACTCACAGGGCAAAAAAGG + Intronic
1108251026 13:48568278-48568300 TGGCACTAAAGCGGAAAAACTGG - Intergenic
1111336234 13:86827499-86827521 TGGCAGTTTCTCAGAAAAACAGG - Intergenic
1117618180 14:57555510-57555532 TGGCTCTCACTTGGAAGAGCAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119642968 14:76328637-76328659 TGGCCCTCATTCAGGAAAACAGG - Intronic
1125605632 15:40938341-40938363 TGCCACTCTCTCTGGAAAACAGG - Exonic
1127525500 15:59788457-59788479 TGGCATTCAGTCTGAAAAAAAGG - Intergenic
1127688808 15:61374663-61374685 TGGCACTGACCAGAAAAAACAGG + Intergenic
1128594397 15:68930705-68930727 CGTCACTCACTCGGATAAGCCGG - Exonic
1130116239 15:81006895-81006917 TCACATTCATTCGGAAAAACAGG - Intergenic
1130155411 15:81345994-81346016 TGGGACTCACTCAGAAAGTCAGG - Intronic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1137870668 16:51947180-51947202 TGACACTCACACTGAAAAGCTGG - Intergenic
1141696766 16:85623940-85623962 TGGCACTCACTCGGTACAGAAGG + Intronic
1142829300 17:2535790-2535812 TGGAACTCACTAGCATAAACTGG + Intergenic
1147811221 17:43171161-43171183 TGGCGAACACTCGGAGAAACAGG + Intronic
1151378233 17:73706499-73706521 TTGAAGTCACTCGGAATAACCGG + Intergenic
1157624405 18:49038143-49038165 TGGCACACACTCCAAAATACTGG - Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
928969586 2:37013882-37013904 TGGCACTCTCTCGGTACAGCTGG + Exonic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
946457677 2:219841145-219841167 TGGCACTAACTGGGACTAACTGG + Intergenic
946737981 2:222773585-222773607 TGGCACAGACTTGGAAAAACTGG + Intergenic
1181491330 22:23262560-23262582 TGACACACACACGGAGAAACGGG - Intronic
960728833 3:120701846-120701868 TTGCATTCACTGGGAAAGACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
965967871 3:174518040-174518062 TTGCACAGACTCGAAAAAACTGG + Intronic
966005347 3:175004443-175004465 CGCCACACACTCGCAAAAACTGG - Intronic
977379920 4:96259413-96259435 TGGTACACACTAGGAAAAAGAGG + Intergenic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
982370284 4:154626697-154626719 TGGCACAAACTCCGAAAAAGTGG + Intergenic
989358277 5:40569614-40569636 TGGCACTCACTGGGATACTCAGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1013784387 6:113763722-113763744 TTGCACTTAGTTGGAAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1023724889 7:43132660-43132682 AGGCACTCACTGGGCAAAATTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1033200174 7:139360927-139360949 TGGAGGTCTCTCGGAAAAACAGG - Intronic
1036084462 8:5598758-5598780 TGGCACCCACTCTGAAAGACTGG + Intergenic
1038952668 8:32433009-32433031 TGGCACTCACTCAGATAAACAGG - Intronic
1039649774 8:39329088-39329110 TGGAATGCACTCGGAAACACTGG - Intergenic
1040333406 8:46403910-46403932 AGGCACTCACAAGCAAAAACGGG + Intergenic
1047524082 8:125617659-125617681 TGGCACTGACTTGGAACTACGGG + Intergenic
1048022907 8:130557009-130557031 TGGTACTCAGAAGGAAAAACTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059988783 9:119844799-119844821 TGGCACTAACTTGGAAGAATGGG + Intergenic
1061441401 9:130606423-130606445 TGGCACCCACACGGAACCACTGG - Intronic
1203654496 Un_KI270752v1:10020-10042 TGGCACTCACTCTGTAGACCAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193483231 X:82053517-82053539 TGGCACTGAGTGGGAAAAAGTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1198375611 X:136036093-136036115 TTGCAATCACTCTGGAAAACTGG - Intronic