ID: 1134001409

View in Genome Browser
Species Human (GRCh38)
Location 16:10785897-10785919
Sequence CCTGTAGGGTACCCAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 3, 1: 11, 2: 14, 3: 17, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134001409_1134001415 -8 Left 1134001409 16:10785897-10785919 CCGGACTTTGGGTACCCTACAGG 0: 3
1: 11
2: 14
3: 17
4: 78
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134001409 Original CRISPR CCTGTAGGGTACCCAAAGTC CGG (reversed) Intronic