ID: 1134001409

View in Genome Browser
Species Human (GRCh38)
Location 16:10785897-10785919
Sequence CCTGTAGGGTACCCAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 3, 1: 11, 2: 14, 3: 17, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134001409_1134001415 -8 Left 1134001409 16:10785897-10785919 CCGGACTTTGGGTACCCTACAGG 0: 3
1: 11
2: 14
3: 17
4: 78
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134001409 Original CRISPR CCTGTAGGGTACCCAAAGTC CGG (reversed) Intronic
902492070 1:16790147-16790169 CCTTTAGGGTGCCCCAAGGCAGG - Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904529461 1:31158739-31158761 CCTGTAGGCCTCCCAAAGCCTGG - Intergenic
911053406 1:93691405-93691427 CCTGTGGGGTACACACAGCCTGG + Intronic
913414944 1:118594764-118594786 ACTGTAAGGTCCACAAAGTCAGG - Intergenic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
922999438 1:229994611-229994633 CTTGTTGGGAACCCAAAGTTGGG - Intergenic
923528376 1:234792390-234792412 CCTTTAGGGTGCCCCAAGGCAGG + Intergenic
1063952535 10:11237369-11237391 TCTGTGGGGTACCCAGATTCAGG + Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1071390604 10:85171667-85171689 CCTGTAAGATATCCAAATTCAGG + Intergenic
1072630078 10:97139764-97139786 CTTGTAGGGGACCCAAAGATAGG - Intronic
1072674685 10:97457001-97457023 CCTGCATGGTACCCTAAGGCAGG - Exonic
1073001168 10:100287073-100287095 CCTGAAGGTTTCCCAAAGTGTGG - Intergenic
1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG + Intergenic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1076674217 10:132139977-132139999 CCTGGAGGGTCCCCAAAGGCAGG + Intronic
1077670388 11:4151902-4151924 CTTAGGGGGTACCCAAAGTCAGG + Intergenic
1080759625 11:35236086-35236108 GCTGTAGGTTAACCAAAGTTGGG + Intergenic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1090804153 11:130192052-130192074 CCTGTGGGATACCCCACGTCAGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1095526180 12:43128638-43128660 CTTGCAGGCTACCCCAAGTCTGG - Intergenic
1102027438 12:109721503-109721525 CCTGGAAGGAACCCAAGGTCAGG - Intronic
1102349096 12:112179123-112179145 CCTGCAGGGCACCCAAGGCCCGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1114447934 14:22803863-22803885 CCTGTAGGGAACGCACAGTGTGG - Intronic
1116951849 14:50885762-50885784 CCTGTAGAGTCCCCAAATCCTGG - Exonic
1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG + Intronic
1118611873 14:67547638-67547660 CCTGTAGGGTGAGCAAAGCCTGG + Intronic
1119420803 14:74506667-74506689 CCTGTGGGCTACCCAAGGTCTGG - Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120226911 14:81800853-81800875 ACTGTAGGGTACCGAAACACTGG - Intergenic
1122386200 14:101350005-101350027 CCTGTAGAGTAGGCAAAGGCTGG - Intergenic
1126385488 15:48089349-48089371 CCTTAAGGGTACCCAAGTTCTGG - Intergenic
1133244482 16:4438774-4438796 CCTTTAGGATGGCCAAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1137553641 16:49456643-49456665 CCTGTCAGGTTCCCAAAGTTGGG - Intergenic
1137752755 16:50879221-50879243 CCTGATGGGTGCCCAAAGCCAGG - Intergenic
1139297696 16:65917575-65917597 CCTGCAGAGTAGCCAAAATCAGG + Intergenic
1140200513 16:72890984-72891006 CCTGTATGGCACCCTAGGTCAGG + Intronic
1143102486 17:4512160-4512182 CCTGTAAGGCCCCCAAAGGCAGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1147863080 17:43535072-43535094 CCTGCGGGGTTCCCAAACTCTGG + Intronic
1156508204 18:37612553-37612575 CCTTTTAGTTACCCAAAGTCAGG - Intergenic
1161690109 19:5727464-5727486 CCTGTAGGGAGTCCATAGTCAGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165477150 19:36037547-36037569 CCAGTAGTGTGCCCACAGTCAGG - Intronic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167237952 19:48326273-48326295 CCTGTATGTAACCCAGAGTCAGG + Intronic
1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG + Intergenic
926226225 2:10968707-10968729 CCTGTAAGCTACTCGAAGTCGGG - Intergenic
932733017 2:74233656-74233678 CTTGAAAAGTACCCAAAGTCAGG - Intronic
942616383 2:177795586-177795608 CTTCTTGGGTACCTAAAGTCAGG + Intronic
948150063 2:235737992-235738014 CCTGTAGGGCACTCAGCGTCCGG + Intronic
1169116446 20:3069383-3069405 CCTGTAGGGAACCCAACCTGAGG - Intergenic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1173855454 20:46247669-46247691 ACTGTAATGTGCCCAAAGTCAGG + Intronic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1181172657 22:21018397-21018419 CCTGGAGAGTACCCAGAGGCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949878266 3:8641264-8641286 CCTTTGGGGTACTCCAAGTCTGG - Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
964607508 3:158572938-158572960 CATGACGGGCACCCAAAGTCCGG - Intronic
967440752 3:189505623-189505645 CCTGAAGGGTTCCCAAAATCAGG - Intergenic
968293104 3:197554331-197554353 TCTGTAGGGTGCTCACAGTCCGG - Intronic
968660717 4:1797716-1797738 CCTGTAGGGACCCCGCAGTCAGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
976318543 4:83685537-83685559 CTTGGAGGGTGCCCAAAGTGGGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
985697015 5:1346382-1346404 CCTGTAGGGGACCCCAAGAGTGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
995015300 5:107302771-107302793 CCTGTAGCCTTCCCAAAGCCAGG + Intergenic
1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG + Intergenic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1016797823 6:148136647-148136669 CCTGTGGGGTCCCCAAACTGTGG + Intergenic
1031335615 7:120527398-120527420 GATGTAGTGTACCGAAAGTCAGG - Intronic
1031500093 7:122503781-122503803 ACTGTTGTGTACCCAAAGCCTGG - Intronic
1033947577 7:146740823-146740845 CCTGAGGGCTACCCAAAGCCTGG + Intronic
1035860186 8:3020077-3020099 GCTGTAGGCTACCCAGGGTCTGG + Intronic
1037302810 8:17470518-17470540 CATGTGGCGTACCCAAAGTATGG - Intergenic
1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1044217334 8:89627465-89627487 TGTGCAGGGTACCCAAAGTTTGG + Intergenic
1044413451 8:91910103-91910125 CCTCCAGGGTACCCAATGTTGGG + Intergenic
1048512771 8:135077762-135077784 CCTGGATGGTACCCAGAGGCAGG - Intergenic
1049457669 8:142701729-142701751 CTTGTTGGGGACCCAAAGGCAGG + Intronic
1049664050 8:143835306-143835328 CCTGTAGGGAACCCCAGCTCTGG - Exonic
1049786572 8:144453810-144453832 CCTGGAGGGCTCCCAAACTCTGG - Intronic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056753580 9:89368482-89368504 CCAGAAGGGTCCCCAGAGTCTGG - Intronic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1061954591 9:133955231-133955253 CCTGTGGGGTCCCCAGAATCTGG - Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1185990094 X:4884234-4884256 CCTGCAGGGTACCCACTTTCTGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196320200 X:114278536-114278558 CCTATAGAGTAGGCAAAGTCTGG - Intergenic
1198218582 X:134579209-134579231 CCTGTAAGGGCCCCAAAGACAGG + Intronic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic