ID: 1134001415

View in Genome Browser
Species Human (GRCh38)
Location 16:10785912-10785934
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 7, 1: 20, 2: 21, 3: 29, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134001403_1134001415 20 Left 1134001403 16:10785869-10785891 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214
1134001408_1134001415 -5 Left 1134001408 16:10785894-10785916 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214
1134001405_1134001415 4 Left 1134001405 16:10785885-10785907 CCTTTGTCACCACCGGACTTTGG 0: 4
1: 7
2: 14
3: 31
4: 231
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214
1134001409_1134001415 -8 Left 1134001409 16:10785897-10785919 CCGGACTTTGGGTACCCTACAGG 0: 3
1: 11
2: 14
3: 17
4: 78
Right 1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG 0: 7
1: 20
2: 21
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901293347 1:8141531-8141553 GCTACTGGTGAGGTTGAGGCGGG + Intergenic
901689353 1:10962564-10962586 CCTACAGAGGGAGCTGAGGCTGG - Intronic
902235593 1:15055363-15055385 GCTACACGTGAGGTTGAGGCAGG + Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
903569075 1:24291104-24291126 CCCACAGGTGGTGATGACACAGG + Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904653555 1:32025152-32025174 CCTACTGGGGGTGCTGAGGTGGG + Intronic
905983823 1:42257625-42257647 CCTACAGGGGAGGGTGAGGCAGG + Intronic
912231467 1:107797821-107797843 CCTCCAGGTGGTATTGGTGCAGG - Intronic
914765797 1:150636632-150636654 CCATCAGATGGTGTTGAGGAGGG + Intergenic
914855288 1:151346247-151346269 CCCCCAGGTGGTGCTGAGGCTGG - Exonic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
915487845 1:156234413-156234435 CTTACAGGTGTAGATGAGGCTGG + Intronic
918653978 1:187001236-187001258 TCTATAGGTGGTGTTTATGCTGG + Intergenic
919747786 1:201019555-201019577 CCTCCAAGTGGAGGTGAGGCGGG - Intronic
920307369 1:205027551-205027573 CCTCCAGGTGATGCTGATGCAGG + Intergenic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
921908883 1:220527284-220527306 CCTACAGGATGTCTTGAGGCAGG + Intergenic
924360616 1:243237791-243237813 GCTACTGGGGGTGGTGAGGCAGG + Intronic
1065138776 10:22700411-22700433 CGTTCAGGTGGTGTTCAGTCTGG - Intronic
1066122055 10:32298827-32298849 GCTGCAGGGGATGTTGAGGCAGG + Intronic
1066476592 10:35752875-35752897 CCCACAGGTGCTGTAGGGGCTGG + Intergenic
1066494818 10:35932636-35932658 CCTACAGGTAGAGGTGAGGTGGG + Intergenic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1066795194 10:39112443-39112465 AATACAGGTTGTGTTGAGGCTGG + Intergenic
1069833231 10:71293693-71293715 CCTACAGGAGGTGGTGACCCTGG + Exonic
1071414785 10:85431077-85431099 CCAACATGTGGGGTTGAGGATGG - Intergenic
1071561047 10:86647066-86647088 CTTACAGGGGCTGCTGAGGCAGG - Intergenic
1072310287 10:94147786-94147808 CCTACAGGTAGACTAGAGGCAGG - Intronic
1072469285 10:95697288-95697310 CCTAAAGGTGGTGGTGGGGGTGG + Intergenic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1073188091 10:101629393-101629415 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1074262726 10:111870376-111870398 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1077113587 11:872892-872914 CCTCCAGGAGGAGGTGAGGCTGG + Intronic
1077114910 11:879775-879797 CCCACAGCTGGAGCTGAGGCAGG + Intronic
1077184386 11:1229780-1229802 GCTGCAGGTGGTGTTGAAGGAGG - Exonic
1078256878 11:9665539-9665561 CCGACAGTTGGGGTGGAGGCAGG - Intronic
1079016583 11:16874032-16874054 CCTCCAGGTGGAAATGAGGCAGG - Intronic
1080039445 11:27743911-27743933 GCTACAGGGGGAGCTGAGGCAGG + Intergenic
1080449756 11:32369004-32369026 CTTCCACGTGGTGTTGAGCCTGG - Intergenic
1081069665 11:38595444-38595466 TCTACAAGTGGGGTTGATGCAGG - Intergenic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1081537262 11:44005001-44005023 CCCACTGGTGGTGGTGAGGTTGG + Intergenic
1083662761 11:64259376-64259398 CCGACAGGTGGTGAGGAGACAGG - Intronic
1083784920 11:64939039-64939061 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1083920337 11:65778917-65778939 CCTGAAGGTGGTGTTGCGGCAGG - Exonic
1084686333 11:70698016-70698038 CCTGCAGGGGAGGTTGAGGCTGG - Intronic
1085528376 11:77177064-77177086 CATCCAGGTTGTGTTGAGGAGGG + Intronic
1086248985 11:84791224-84791246 TCTTCAGCTGGTGTTGAGGGAGG - Intronic
1086399391 11:86448171-86448193 CCTGGAGGAGGTGGTGAGGCTGG - Exonic
1087571090 11:99928517-99928539 CTTCCATGTGGTGTTGAGCCTGG - Intronic
1087580690 11:100048017-100048039 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1089844999 11:121451810-121451832 CCTGGAGGTGGGGATGAGGCCGG + Intergenic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1093963012 12:25296010-25296032 CCTACCTGTGGTGTAGAGGTTGG - Intergenic
1095544148 12:43345091-43345113 CTTTCATGTGGTGTTGAGCCTGG - Intergenic
1095882913 12:47157476-47157498 CCTACTGGGGAGGTTGAGGCAGG + Intronic
1097825599 12:64172337-64172359 CCTAGAGGTAGTGTTGGGGGTGG - Intergenic
1099615772 12:84933580-84933602 GCTACATGGGGTGCTGAGGCAGG - Intergenic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1106505050 13:30363932-30363954 CATAGAGGTGCTATTGAGGCTGG - Intergenic
1107097655 13:36553589-36553611 CCTACAAGTGGATTTGAAGCTGG + Intergenic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1107760929 13:43677406-43677428 CGTACAGGTGGCTCTGAGGCTGG + Intronic
1109124535 13:58503396-58503418 CTTAAAGGTGGTGTTGTGTCCGG + Intergenic
1112875518 13:104033553-104033575 CCTACTGGTGAGGCTGAGGCAGG - Intergenic
1113496649 13:110735715-110735737 CCTACAGGGGAGGCTGAGGCAGG - Intergenic
1114343731 14:21772949-21772971 CCTCCAGGTGGTGGTGACGGTGG - Intergenic
1114786132 14:25601628-25601650 CCTACAGCTTGTGTTTAGGAGGG + Intergenic
1117388628 14:55241529-55241551 CCTACAGGGGAGGGTGAGGCAGG + Intergenic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1120483511 14:85082326-85082348 GCTACAGGTGGTGGGGAGGGTGG - Intergenic
1120627800 14:86850595-86850617 GCTACTTGTGGGGTTGAGGCAGG + Intergenic
1120995983 14:90419128-90419150 CCCTCAGGGGGTGTTGAGGCCGG + Intergenic
1124138825 15:27059289-27059311 GCTACAGGTGGTTTGGAAGCGGG + Intronic
1127142583 15:55993225-55993247 CCTTCAGGAAGTGTTGAGGAGGG - Intronic
1129160158 15:73742911-73742933 CCTCCAGGTGCTGTTGCTGCTGG + Intronic
1129522335 15:76193762-76193784 CCCACAGCTGGTGGGGAGGCAGG - Intronic
1130162070 15:81411573-81411595 CCTACAGTTATTGTTGAAGCAGG + Intergenic
1132335597 15:101046408-101046430 ACTCCAGGTGGTTTTGAGGTGGG - Intronic
1132342631 15:101087900-101087922 CCTCAATGTGGTGTTGAGGGTGG + Intergenic
1133646191 16:7766879-7766901 CCTGCAGGTAGTGTTGAGGAGGG - Intergenic
1133728120 16:8556008-8556030 CCGACAGGTGGTGTTGAAGGAGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1136596397 16:31253142-31253164 CCTTCAGGTGGTGGTGTGCCTGG + Intergenic
1137625208 16:49903419-49903441 CCTACAGGTGGTGCAGAAGCTGG - Intergenic
1139195939 16:64918577-64918599 CCTGCAGGTGGTGCTGGGGATGG - Intergenic
1140786620 16:78348567-78348589 GCTACTGGTGGGGCTGAGGCAGG - Intronic
1142434280 16:90047161-90047183 CCCACAGCTGGTGTGGACGCAGG - Intergenic
1142664541 17:1455468-1455490 CCTACAAGTGGCTTTTAGGCTGG - Intronic
1142738195 17:1915007-1915029 CCTGCAGGGGGTCTAGAGGCGGG + Intergenic
1143000210 17:3789610-3789632 GCTACAGGGGAGGTTGAGGCAGG - Intronic
1143385477 17:6527483-6527505 CCTACTGGTGGTGGTGGTGCTGG - Intronic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1144844031 17:18206612-18206634 CCTAAAGGTGGACTTGAGGAGGG + Intronic
1145010182 17:19363586-19363608 CCAACAGATGCTGTTGGGGCTGG - Intronic
1145185502 17:20790619-20790641 GCTACAGGAGATGCTGAGGCAGG - Intergenic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1148932799 17:51140721-51140743 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
1150122572 17:62616413-62616435 CCTCCAGGTGTTGCTGATGCAGG + Intergenic
1151126775 17:71853865-71853887 CCTACTGGGGATGCTGAGGCAGG - Intergenic
1152402150 17:80073371-80073393 CCAACATGTGGTGCAGAGGCAGG - Intronic
1154001035 18:10482549-10482571 CCTGTAGGTGGTGCTGAGCCAGG + Intronic
1155788142 18:29927800-29927822 GCTACAGGGGATGCTGAGGCAGG + Intergenic
1156338417 18:36188994-36189016 CCTACAGGTGCTGGGGAGGGAGG + Intronic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161205625 19:3039779-3039801 CCTACAGGTTGTGTTAGCGCTGG - Intronic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164215405 19:23140838-23140860 CCTACAGGGGAGGCTGAGGCAGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165350399 19:35272061-35272083 CCTAAAGGTGGTGATGGGACTGG + Intronic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166303117 19:41923096-41923118 CTCACAGGTGGTGGTGAGGATGG - Intronic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
1168353447 19:55688866-55688888 CCCACAGCTGCTGATGAGGCTGG - Exonic
927713021 2:25337429-25337451 CTTACAGGTGGTTGTGAGGATGG - Intronic
927983514 2:27390826-27390848 ACTAGAGGTGGTGGTGCGGCAGG - Intronic
928836974 2:35559085-35559107 CCTACATGTGGTGTTGGGCCAGG + Intergenic
931284648 2:60821665-60821687 CCAAAAGGTGATATTGAGGCTGG - Intergenic
932442895 2:71749114-71749136 TTTACAGGTGGTGGTGAGTCTGG + Intergenic
932605486 2:73162981-73163003 CCTAGAGGAGGTGTGGAGGAAGG + Intergenic
932723668 2:74159112-74159134 CTTAAAGGAGGTGTTGAGGTGGG + Exonic
933411022 2:81925160-81925182 ACTGCAGGGGGTGCTGAGGCAGG + Intergenic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
934522616 2:95029265-95029287 CCTACAGGTGGCCCTGAGGACGG - Intronic
934525343 2:95048389-95048411 GGTACAGGTGGTGTGGGGGCTGG - Intronic
934777208 2:96947047-96947069 CCTACAGCTGGGGCAGAGGCGGG + Intronic
935237379 2:101150686-101150708 GCTCCAGGTGGTGTCGTGGCTGG - Intronic
935524254 2:104146108-104146130 GCTACTGGGGGTGCTGAGGCGGG - Intergenic
940103746 2:150073560-150073582 ACAACAGGTGCTGGTGAGGCTGG + Intergenic
944167879 2:196742682-196742704 CCTACAGGTGCAGTTCAAGCTGG - Intronic
945689827 2:213019757-213019779 TTTACAGGTGGTGCTGAAGCTGG - Intronic
946114603 2:217450468-217450490 CCTGCAGGTGGCCTTGAGACAGG + Intronic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
948899794 2:240950504-240950526 GCAACAGGTGATGGTGAGGCTGG + Intronic
949052905 2:241906881-241906903 CGTTCAGGTCGTGTTGAGGTGGG - Intergenic
1169008706 20:2231709-2231731 CCTTCAGGTGGGGCTGAGGTGGG - Intergenic
1169111542 20:3037312-3037334 GCTGCAGGTGGTGTGGTGGCAGG - Intronic
1169831809 20:9833544-9833566 CATACAGGTGGTGTGGAGAGTGG - Intronic
1170770104 20:19325332-19325354 GCTACTGGTGGGGCTGAGGCAGG + Intronic
1171010187 20:21505421-21505443 CCGACAGCTGGTTTTGAAGCGGG + Intergenic
1171197172 20:23208648-23208670 CCTACAAGTTGAGTTGAGCCTGG - Intergenic
1175176217 20:57114035-57114057 AGTACTGGTGGTGTTGATGCTGG + Intergenic
1175409132 20:58754502-58754524 CCTACAGGAGGGGTGGAGGCTGG - Intergenic
1176193908 20:63828080-63828102 CCTAAAAGTGGTTCTGAGGCTGG - Intronic
1177233166 21:18349274-18349296 CAAGAAGGTGGTGTTGAGGCAGG - Intronic
1177693510 21:24540943-24540965 ACTACAGGAGCTGTGGAGGCAGG - Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1180008951 21:45037159-45037181 CCTCCAGGTGGTGGGGAGGAAGG + Intergenic
1180185794 21:46138612-46138634 CCTACAGGAGGGTCTGAGGCGGG - Exonic
1182344938 22:29656048-29656070 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1183108580 22:35631782-35631804 CCAAGTGGTGGTGGTGAGGCTGG - Intronic
1183229252 22:36570649-36570671 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1185148869 22:49153119-49153141 GCTCCAGGTGGGGTTCAGGCTGG + Intergenic
950179038 3:10897979-10898001 CTTCCACGTGGTGTTGAGCCTGG - Intronic
954670005 3:52285697-52285719 GCTACTGGTGGGGCTGAGGCAGG - Intronic
955435921 3:58899097-58899119 CCTACAGGTGCAGTTCAGGCTGG - Intronic
958262343 3:91396130-91396152 GCTACTTGGGGTGTTGAGGCGGG + Intergenic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961629481 3:128285533-128285555 GCTACAGGTGGTGAGGAGGAGGG - Intronic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
962918347 3:139928924-139928946 CCTACAGCTGTGGTGGAGGCTGG + Intergenic
963748374 3:149148917-149148939 CCTACAGGTGGAGGTAAGTCAGG + Intronic
964455845 3:156865198-156865220 CATTAAGGTAGTGTTGAGGCTGG + Intronic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
967851251 3:194084150-194084172 CATACAGGTGGTGTTGATTCAGG + Intergenic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
968128791 3:196179980-196180002 CCTCCAGGTGGAGTTGGAGCTGG - Intergenic
968414506 4:418501-418523 CCTGGAGGGGGTGCTGAGGCAGG + Intergenic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969784312 4:9441981-9442003 GCTACAGGGGAGGTTGAGGCAGG + Intergenic
969944315 4:10767361-10767383 ACTAGAGGTAGTTTTGAGGCAGG + Intergenic
972370559 4:38419462-38419484 CTTCCATGTGGTGTTGAGCCTGG - Intergenic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
973888998 4:55350872-55350894 GCTACTGGGGGTGCTGAGGCAGG - Intronic
975624826 4:76335689-76335711 GCTACTGGGGGTGCTGAGGCAGG - Intronic
975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG + Intronic
978145409 4:105366143-105366165 CTTCCATGTGGTGTTGAGCCTGG + Intergenic
978400052 4:108321760-108321782 CCTACAGGGGGTTCTGAAGCTGG - Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
983094196 4:163542657-163542679 CCTACAGGTGATTCTGATGCTGG - Intronic
984244357 4:177257446-177257468 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
985421771 4:189791633-189791655 CCTACAGGGGAGGCTGAGGCAGG - Intergenic
986672326 5:10153308-10153330 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
986859291 5:11906462-11906484 CCTACAGATACTGTTGGGGCTGG + Intergenic
988103159 5:26708293-26708315 CATCCAAGAGGTGTTGAGGCTGG + Intergenic
988615425 5:32770316-32770338 GCTACTTGTGGGGTTGAGGCAGG + Intronic
991677442 5:69101843-69101865 GCTACAAGGGGTGCTGAGGCAGG + Intronic
992270504 5:75058170-75058192 CCAACAGGTGATGTGGAGGTGGG - Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
992779171 5:80112648-80112670 CCTTCATGTGATGTTTAGGCCGG + Intronic
993713479 5:91251026-91251048 GCTACTGGTGAGGTTGAGGCGGG + Intergenic
994331102 5:98507568-98507590 CCTATTGGTGGTGTTGGGGGAGG + Intergenic
995910055 5:117176293-117176315 GCCACAGCTGGTGTTGAGGCAGG + Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
999139379 5:149347731-149347753 CTTACAGGTTGTGGTGAGGAAGG + Intronic
1001490568 5:172151882-172151904 CCCACAGAAGGTGTTGCGGCTGG - Intronic
1001511058 5:172322233-172322255 CCTACAGGAAGTGGGGAGGCTGG + Intergenic
1002792490 6:446415-446437 CCTGCAGGGGAAGTTGAGGCAGG + Intergenic
1004138215 6:12989585-12989607 CCTACAGGCAGTGTTGAGACTGG - Intronic
1004600029 6:17140540-17140562 CCTTCAGGTAGTTATGAGGCAGG + Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1007766475 6:44163306-44163328 CTGACAGGGGGTGTTGAGGATGG - Intronic
1009424716 6:63501248-63501270 GCTACTGGGGATGTTGAGGCAGG + Intergenic
1009593841 6:65709140-65709162 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
1011202193 6:84848844-84848866 CTTACAGGTGATGTTCAGGAGGG + Intergenic
1012178444 6:96120380-96120402 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014588355 6:123229795-123229817 CCTACCATTGGTGCTGAGGCTGG - Intronic
1014777489 6:125527958-125527980 CCTAGAGGAGGTCTTGAGGGAGG - Intergenic
1015479822 6:133696196-133696218 CCTACAGGTGGCGATGAGAAAGG - Intergenic
1017279386 6:152607094-152607116 CCTACTGGGGGGGCTGAGGCAGG - Intronic
1017703122 6:157095107-157095129 CCTCCAAGTGATGCTGAGGCAGG - Intronic
1018860288 6:167706453-167706475 CGTCGAGGTGGTGTTGGGGCAGG + Intergenic
1019287008 7:228703-228725 CCCACAGGTGCCGTGGAGGCTGG - Exonic
1021905638 7:25330322-25330344 CTTACACGTGATGCTGAGGCTGG + Intergenic
1023210490 7:37798781-37798803 CCTCCAGGTGATTTTGATGCAGG + Intronic
1025769610 7:64491725-64491747 GCTACTGGGGGGGTTGAGGCAGG + Intergenic
1029815464 7:103090074-103090096 CCTACAGGTAGAGTTGGGGAAGG + Intronic
1031645575 7:124221556-124221578 CTTCCACGTGGTGTTGAGACTGG + Intergenic
1033685897 7:143641186-143641208 GCTAGAGGTGCTGGTGAGGCTGG + Intronic
1033689846 7:143726129-143726151 GCTAGAGGTGCTGGTGAGGCTGG - Intronic
1033698716 7:143816435-143816457 GCTAGAGGTGCTGGTGAGGCTGG - Intergenic
1034367165 7:150561082-150561104 CCCGCAGGTAGTGTTGAGGCTGG - Intergenic
1035295791 7:157866584-157866606 CATAGAGGTGGAGCTGAGGCTGG + Intronic
1035337701 7:158140669-158140691 CCTGCAGGTGGGGCTGGGGCAGG + Intronic
1036960306 8:13238399-13238421 GCTACAGGGGGAGGTGAGGCAGG + Intronic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1039093985 8:33863722-33863744 ATTGCAAGTGGTGTTGAGGCAGG - Intergenic
1040111867 8:43570304-43570326 CCTTCAGGGGAGGTTGAGGCAGG - Intergenic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1041096396 8:54354674-54354696 CCCAGAGGTGGTGAGGAGGCCGG + Intergenic
1041434958 8:57828828-57828850 GCTTCAGGTGGGGTTGAGGAAGG - Intergenic
1042927419 8:73980198-73980220 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1043370333 8:79583865-79583887 CTTACATGTGGTGTTGAGCCTGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1043874071 8:85464566-85464588 GCCACAGGTGGTGCTGAAGCTGG - Intronic
1044113366 8:88303543-88303565 CCTATAGGTGCAGTTTAGGCTGG + Intronic
1046716631 8:117574862-117574884 GATACAGTTGTTGTTGAGGCAGG - Intergenic
1049378417 8:142300476-142300498 CCTGCAGATGGAGGTGAGGCTGG - Exonic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1055850112 9:80616819-80616841 CCTACAGTTGAGGTTGAGGATGG + Intergenic
1055878466 9:80970719-80970741 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057127373 9:92628977-92628999 GCTACAGGGGAGGTTGAGGCAGG + Intronic
1057618997 9:96619061-96619083 CCTAAAGGGGGTGTGGCGGCCGG + Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1060084356 9:120683156-120683178 TCTCCAGGTGATTTTGAGGCTGG - Intronic
1060376548 9:123119647-123119669 CCAACAGGTGTTGGAGAGGCAGG - Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1061710591 9:132484958-132484980 GCTACAGGGGAGGTTGAGGCGGG - Intronic
1062257238 9:135632777-135632799 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1186675327 X:11810843-11810865 CCTCCAAGAGGTGCTGAGGCTGG + Intergenic
1188587960 X:31800341-31800363 CTTACATGTGGTGTTGGGCCTGG - Intronic
1190186621 X:48240221-48240243 GCTACTAGTGGTGCTGAGGCAGG - Intronic
1190448118 X:50551210-50551232 GCTACAGTTGATGTTGAGGGTGG - Intergenic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1190732492 X:53234736-53234758 CCCACAGGTGGGGCTGAGGCGGG + Exonic
1194906950 X:99589420-99589442 TCCAAAGGTGGTGTTGTGGCAGG - Intergenic
1195131730 X:101860215-101860237 CCCAAAGGAGGTGTTGATGCTGG + Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1195915047 X:109927732-109927754 CTCACAGGTGGTGTGAAGGCCGG + Intergenic
1197442846 X:126511979-126512001 CTTACACATGGTGTTGAGCCTGG - Intergenic
1198411788 X:136377302-136377324 GCTACATGTGAGGTTGAGGCAGG - Intronic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1199514522 X:148661025-148661047 CCTACAGGGGGTGGTGTAGCTGG + Intronic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201485950 Y:14494883-14494905 GCTACTGGTGAGGTTGAGGCAGG + Intergenic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic