ID: 1134001778

View in Genome Browser
Species Human (GRCh38)
Location 16:10788505-10788527
Sequence CTTACGGGTGGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 17, 2: 24, 3: 25, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134001778_1134001788 4 Left 1134001778 16:10788505-10788527 CCAGCCTCAACACCACCCGTAAG 0: 1
1: 17
2: 24
3: 25
4: 123
Right 1134001788 16:10788532-10788554 CCGAAGTCCGGTGGTGACAAAGG 0: 1
1: 10
2: 16
3: 24
4: 106
1134001778_1134001783 -8 Left 1134001778 16:10788505-10788527 CCAGCCTCAACACCACCCGTAAG 0: 1
1: 17
2: 24
3: 25
4: 123
Right 1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG 0: 1
1: 4
2: 13
3: 19
4: 25
1134001778_1134001785 -5 Left 1134001778 16:10788505-10788527 CCAGCCTCAACACCACCCGTAAG 0: 1
1: 17
2: 24
3: 25
4: 123
Right 1134001785 16:10788523-10788545 GTAAGGTACCCGAAGTCCGGTGG 0: 1
1: 3
2: 19
3: 23
4: 24
1134001778_1134001790 20 Left 1134001778 16:10788505-10788527 CCAGCCTCAACACCACCCGTAAG 0: 1
1: 17
2: 24
3: 25
4: 123
Right 1134001790 16:10788548-10788570 ACAAAGGAATGAGAAGAGACAGG 0: 23
1: 18
2: 19
3: 67
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134001778 Original CRISPR CTTACGGGTGGTGTTGAGGC TGG (reversed) Intronic
902511489 1:16969258-16969280 GTCCCGGGTGCTGTTGAGGCTGG - Exonic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
909569963 1:77098441-77098463 CTTGAGGGAGGTGTTGAGGCAGG - Intronic
909593184 1:77375309-77375331 TTTACGTGCTGTGTTGAGGCAGG + Intronic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
915467587 1:156106481-156106503 CTGACGGCTGGTGCTGACGCAGG - Intronic
915487845 1:156234413-156234435 CTTACAGGTGTAGATGAGGCTGG + Intronic
916123724 1:161550882-161550904 GTTAGGGGTGGAGTGGAGGCAGG + Intergenic
916133610 1:161632245-161632267 GTTAGGGGTGGAGTGGAGGCAGG + Intronic
919860715 1:201737985-201738007 GTTTCGGGTGGTGGTGAGGATGG + Intronic
920278382 1:204825342-204825364 CTTAAGGGTGGGGTTTAGCCGGG + Intergenic
920795610 1:209133370-209133392 CTTAAGGGTGGGGTTTAGCCAGG + Intergenic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
923361656 1:233217894-233217916 CTTACGTGTATTGGTGAGGCGGG + Exonic
924675763 1:246176253-246176275 CTTATGGGTGTAGTTGAGGAAGG - Intronic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1066795194 10:39112443-39112465 AATACAGGTTGTGTTGAGGCTGG + Intergenic
1067174447 10:43933679-43933701 CTTAAGGGTGGGGTTTAGCCAGG - Intergenic
1067690011 10:48495810-48495832 CTTGCTGGCTGTGTTGAGGCAGG + Intronic
1071561047 10:86647066-86647088 CTTACAGGGGCTGCTGAGGCAGG - Intergenic
1072429184 10:95356057-95356079 CTTCCGGATGGTGGTGAAGCGGG + Intronic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1074262726 10:111870376-111870398 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1079418551 11:20264099-20264121 CTGCCGTGTGGTGCTGAGGCTGG + Intergenic
1079437639 11:20474094-20474116 CGTACGGGTGCAGTTCAGGCTGG - Intronic
1080449756 11:32369004-32369026 CTTCCACGTGGTGTTGAGCCTGG - Intergenic
1080898947 11:36469401-36469423 CTAAGGGGAGATGTTGAGGCTGG - Intergenic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1085385281 11:76154255-76154277 TTTCCGGGTGGTGTGGAGGACGG - Intergenic
1087571090 11:99928517-99928539 CTTCCATGTGGTGTTGAGCCTGG - Intronic
1087887190 11:103494747-103494769 CTGAAGGGTGGAGTTTAGGCAGG - Intergenic
1089638187 11:119829969-119829991 TTCAGGGGTGGTGTTGAGGCAGG - Intergenic
1090341963 11:126031816-126031838 TTCACGGGTGGTGTAGAGTCAGG - Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1095544148 12:43345091-43345113 CTTTCATGTGGTGTTGAGCCTGG - Intergenic
1096321291 12:50615628-50615650 CTTAAGGGTGGGGTTGGGGCTGG + Intronic
1098095769 12:66954478-66954500 CTTACTGGTGTGGTTGAGACAGG - Intergenic
1098198068 12:68023480-68023502 CTTAGGGAAGATGTTGAGGCTGG - Intergenic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1101459256 12:104873169-104873191 GTTAGGGGTGGAGGTGAGGCAGG - Intronic
1103952336 12:124557999-124558021 CTGCCGGGTGGGGTTGGGGCCGG - Intronic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1107502839 13:40998033-40998055 CTTACCCGTGAGGTTGAGGCGGG + Intronic
1109124535 13:58503396-58503418 CTTAAAGGTGGTGTTGTGTCCGG + Intergenic
1112019200 13:95357063-95357085 CTTAAGGGTGGGGTTTAGCCAGG + Intergenic
1119392377 14:74299746-74299768 CTTTGGGGTGCTGATGAGGCAGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1122853229 14:104547816-104547838 CTGATGGGTGGTCTGGAGGCTGG + Intronic
1127811277 15:62567725-62567747 CTTGGGGGTGGGGTTGAGGAAGG + Intronic
1129863902 15:78887754-78887776 CTTAGGGGTGGGGATGAGGAGGG - Intronic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1135678352 16:24436419-24436441 CTTAAGGGTGGGGTTTAGCCAGG - Intergenic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1143740894 17:8953353-8953375 CTAAAGGGTGGGGTTGAGGAGGG - Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1147156910 17:38548612-38548634 ATGATGGGTGGTGTGGAGGCTGG + Exonic
1148812274 17:50301052-50301074 CTTGGTGGTGGTGTGGAGGCTGG + Intergenic
1153874944 18:9361604-9361626 TTTCCTGCTGGTGTTGAGGCTGG + Intronic
1156377889 18:36531139-36531161 CTTGCTGGTGGTTTTGTGGCTGG + Intronic
1157485475 18:48084110-48084132 CTGAAGGGTGGTGTTGAGGAAGG + Intronic
1160908279 19:1462147-1462169 CTCACGGGTGGCGACGAGGCTGG - Exonic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1161989489 19:7676637-7676659 CTGAGGGGTGGAGCTGAGGCTGG + Exonic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1164966225 19:32487191-32487213 CTTAAGGGTGGGGTTTAGCCGGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166303117 19:41923096-41923118 CTCACAGGTGGTGGTGAGGATGG - Intronic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166609621 19:44179066-44179088 GTTACTTGGGGTGTTGAGGCAGG + Intergenic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167881332 19:52460876-52460898 AAAATGGGTGGTGTTGAGGCTGG - Intronic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
927713021 2:25337429-25337451 CTTACAGGTGGTTGTGAGGATGG - Intronic
932442895 2:71749114-71749136 TTTACAGGTGGTGGTGAGTCTGG + Intergenic
932723668 2:74159112-74159134 CTTAAAGGAGGTGTTGAGGTGGG + Exonic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
935729901 2:106056575-106056597 CTTAAGGGTGGAGTTTAGCCAGG + Intergenic
937326171 2:120990539-120990561 GTTTCGGGGGGTGGTGAGGCGGG - Exonic
938079362 2:128361376-128361398 CTTAGGGGAGGTCATGAGGCTGG + Intergenic
939638628 2:144612563-144612585 CTTGGGGATGGAGTTGAGGCTGG + Intergenic
945689827 2:213019757-213019779 TTTACAGGTGGTGCTGAAGCTGG - Intronic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1168990951 20:2095328-2095350 CTTACGGTCGGTGATGTGGCTGG - Intergenic
1173728370 20:45312274-45312296 CTTTCGGCTGGTGCTGCGGCTGG + Exonic
1174435319 20:50502316-50502338 CTTCCGGGTGGTAGAGAGGCAGG + Intergenic
1175176217 20:57114035-57114057 AGTACTGGTGGTGTTGATGCTGG + Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1181024811 22:20122100-20122122 CTTTCTGGTGGTGTTGTGACGGG + Intronic
1181710845 22:24687085-24687107 CTTATGGTTGGTGATGAGGCAGG + Intergenic
1183565210 22:38609579-38609601 CAAACGGTTGTTGTTGAGGCTGG - Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1184731630 22:46373902-46373924 CTTAAGCCTGGGGTTGAGGCGGG - Intronic
950179038 3:10897979-10898001 CTTCCACGTGGTGTTGAGCCTGG - Intronic
954410362 3:50367956-50367978 CTTAAGGGTGGGGGTGAGGGTGG - Intronic
955404715 3:58618779-58618801 CTGGAGGGTGGTGTTGGGGCAGG + Intronic
955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG + Intronic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
962697431 3:137963858-137963880 CTTCTTGGTGCTGTTGAGGCAGG - Intergenic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
966208043 3:177424679-177424701 CTTGGTGCTGGTGTTGAGGCTGG + Intergenic
967751607 3:193121902-193121924 CTTAAGGGTGGGGTTTAGCCGGG + Intergenic
967851251 3:194084150-194084172 CATACAGGTGGTGTTGATTCAGG + Intergenic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
969467818 4:7368098-7368120 TTCACGTGTGGTGGTGAGGCGGG + Intronic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969691767 4:8707782-8707804 CTTGTGGGTGGTGGTGAGGATGG + Intergenic
971076382 4:23153805-23153827 CTTAGTGGTGGTGTTAATGCTGG - Intergenic
972370559 4:38419462-38419484 CTTCCATGTGGTGTTGAGCCTGG - Intergenic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG + Intronic
975713538 4:77183984-77184006 CTCCCGGGAGGTGTTGAGGAGGG + Intronic
977666923 4:99653317-99653339 CGTCCGGGTGGTGTTGGTGCTGG + Exonic
978145409 4:105366143-105366165 CTTCCATGTGGTGTTGAGCCTGG + Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
984432118 4:179663073-179663095 CTTACGGATGGTGTTAAGTGAGG - Intergenic
984865108 4:184274581-184274603 CTTTGGGGTGGAGTTGGGGCTGG - Intergenic
987644317 5:20648860-20648882 GTTACTGGCGGTGTTGAGTCGGG - Intergenic
991944194 5:71883715-71883737 TTTACGGGTGGGGCTGAGCCAGG + Intergenic
992464628 5:76991611-76991633 CTTTAGGGTGGTTTTTAGGCCGG - Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
993243898 5:85426887-85426909 CTTAAGGGTGGAGTTGGGGGTGG + Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
999099997 5:149015645-149015667 CTTATGGCTGATGTTCAGGCAGG - Intronic
999139379 5:149347731-149347753 CTTACAGGTTGTGGTGAGGAAGG + Intronic
1004482362 6:16033000-16033022 AGTTGGGGTGGTGTTGAGGCAGG - Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1007278737 6:40694663-40694685 ATTAAGGGTGGGGCTGAGGCTGG - Intergenic
1007407443 6:41643135-41643157 CTGCGGGGTGGTGTTGAGGCTGG - Intronic
1007766475 6:44163306-44163328 CTGACAGGGGGTGTTGAGGATGG - Intronic
1008898974 6:56589563-56589585 CTTTGGGGTGGTGTTAAGTCAGG - Intronic
1011202193 6:84848844-84848866 CTTACAGGTGATGTTCAGGAGGG + Intergenic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1019802702 7:3100000-3100022 ATTACGGGTGTGGTTGGGGCTGG + Intergenic
1021905638 7:25330322-25330344 CTTACACGTGATGCTGAGGCTGG + Intergenic
1029996242 7:105011452-105011474 CTTTTGGGTGGTGTAGAGGGTGG - Intergenic
1031540724 7:122991634-122991656 CTTAGGCGTGGTGTAGAGGCTGG + Intergenic
1031645575 7:124221556-124221578 CTTCCACGTGGTGTTGAGACTGG + Intergenic
1035101857 7:156404155-156404177 CTTGTTGGTGGTGTTAAGGCAGG - Intergenic
1036206737 8:6811267-6811289 CTTAGGGGTGGACGTGAGGCAGG + Exonic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1037987763 8:23300214-23300236 GTTACGTGTGGGGTGGAGGCGGG + Intronic
1038142717 8:24864073-24864095 TTTTGGGGTGGTGGTGAGGCAGG - Intergenic
1039093985 8:33863722-33863744 ATTGCAAGTGGTGTTGAGGCAGG - Intergenic
1040110156 8:43563669-43563691 CTTTCGGGGGACGTTGAGGCGGG - Intergenic
1040111589 8:43569218-43569240 CTTCCGGGGGAGGTTGAGGCAGG - Intergenic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1043370333 8:79583865-79583887 CTTACATGTGGTGTTGAGCCTGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1052824350 9:33164246-33164268 CTTGCGGGTGGTTTTGAGGTTGG - Intronic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1055156079 9:73065116-73065138 CTTAAGGGTGGGGTTCAGGCAGG - Intronic
1055878466 9:80970719-80970741 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057362990 9:94392038-94392060 CTGACGTGTGTTTTTGAGGCTGG + Intronic
1058031322 9:100201169-100201191 CATAAGGGTGGTATGGAGGCAGG + Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1188587960 X:31800341-31800363 CTTACATGTGGTGTTGGGCCTGG - Intronic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1192103359 X:68289172-68289194 CTTTGTGGTGGTGTTGCGGCAGG - Intronic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1195915047 X:109927732-109927754 CTCACAGGTGGTGTGAAGGCCGG + Intergenic
1196159900 X:112471481-112471503 CTTTTGGGGGGCGTTGAGGCAGG + Intergenic
1197442846 X:126511979-126512001 CTTACACATGGTGTTGAGCCTGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1200096632 X:153667649-153667671 CTCAGGGCTGGTGCTGAGGCTGG - Intergenic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic