ID: 1134001783

View in Genome Browser
Species Human (GRCh38)
Location 16:10788520-10788542
Sequence CCCGTAAGGTACCCGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 4, 2: 13, 3: 19, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134001778_1134001783 -8 Left 1134001778 16:10788505-10788527 CCAGCCTCAACACCACCCGTAAG 0: 1
1: 17
2: 24
3: 25
4: 123
Right 1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG 0: 1
1: 4
2: 13
3: 19
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134001783 Original CRISPR CCCGTAAGGTACCCGAAGTC CGG Intronic