ID: 1134001783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:10788520-10788542 |
| Sequence | CCCGTAAGGTACCCGAAGTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 62 | |||
| Summary | {0: 1, 1: 4, 2: 13, 3: 19, 4: 25} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134001778_1134001783 | -8 | Left | 1134001778 | 16:10788505-10788527 | CCAGCCTCAACACCACCCGTAAG | 0: 1 1: 17 2: 24 3: 25 4: 123 |
||
| Right | 1134001783 | 16:10788520-10788542 | CCCGTAAGGTACCCGAAGTCCGG | 0: 1 1: 4 2: 13 3: 19 4: 25 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134001783 | Original CRISPR | CCCGTAAGGTACCCGAAGTC CGG | Intronic | ||