ID: 1134005679

View in Genome Browser
Species Human (GRCh38)
Location 16:10817788-10817810
Sequence GGCCCTCCATGGCTGCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134005675_1134005679 -8 Left 1134005675 16:10817773-10817795 CCACCTCCTCAGAGAGGCCCTCC 0: 5
1: 16
2: 66
3: 244
4: 941
Right 1134005679 16:10817788-10817810 GGCCCTCCATGGCTGCACTAAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134005679 Original CRISPR GGCCCTCCATGGCTGCACTA AGG Intronic
900312032 1:2038223-2038245 CGACCTCCATGGCTGCACAGAGG + Intergenic
900336752 1:2168032-2168054 GTCCCTCCACGGGTGCACTGAGG + Intronic
902188186 1:14741066-14741088 GGACCTCCATGGTAGCACAAGGG - Intronic
906266551 1:44435315-44435337 GGGCTTCCATGTCTGCACAATGG + Intronic
913123558 1:115764711-115764733 GGCCCTCCAGAGCTGGACTCTGG + Intronic
915594621 1:156889025-156889047 GGCCCTCCTAGGCTGCGATAAGG - Intergenic
920606424 1:207392402-207392424 GTACCTTCACGGCTGCACTAAGG + Intergenic
921285855 1:213608406-213608428 AGGCCTCCGGGGCTGCACTAGGG + Intergenic
921307328 1:213810094-213810116 GGCCCTCCAAGGCTTCTCAACGG - Intergenic
922857156 1:228784774-228784796 GGCCCTCCCCTGCTGCACCATGG + Intergenic
1067080515 10:43209823-43209845 GACCCTGCATGGATGCTCTAAGG + Intronic
1068964191 10:62895370-62895392 GGAGCTCCATGCCTGCACAATGG - Intronic
1072475814 10:95758771-95758793 GGCCCTCTATGACTGCTATATGG - Intronic
1072556092 10:96514452-96514474 CGCCCTTCATGGCTCGACTAGGG - Intergenic
1077503679 11:2920491-2920513 GGCCTGCCATGGCTGCAGTGGGG + Intronic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1082969717 11:59006670-59006692 TTCCCTCCATGGCTGGACTCTGG + Intronic
1083233572 11:61338191-61338213 TGCACTTCATGGCAGCACTAAGG - Intronic
1086810609 11:91305626-91305648 AGACCTCCCTGGCTACACTATGG - Intergenic
1091051614 11:132377736-132377758 GTCCCTCCAGGGATGCAATATGG - Intergenic
1092768243 12:11872290-11872312 GGCCCACGAGGGCAGCACTATGG - Intronic
1097902989 12:64891765-64891787 GGCTATCCCTGGCTGCACAAAGG + Intergenic
1100453418 12:94729340-94729362 GGCCCTCCACACCTCCACTATGG - Intergenic
1104744996 12:131204937-131204959 TGCCCTGCACGGCTGCTCTAGGG - Intergenic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1106551090 13:30771751-30771773 GGTCCTCAATGTCAGCACTATGG + Intergenic
1107744418 13:43489590-43489612 CTGCCCCCATGGCTGCACTAAGG - Intronic
1108680050 13:52772277-52772299 AGCCCTCCATGGCTTCAGAAAGG - Intergenic
1114218041 14:20672290-20672312 GGCCCACAATGGCTGCAGTTGGG - Intergenic
1117555970 14:56884188-56884210 CTCTCTCCATGGCTGCATTATGG - Intergenic
1118115954 14:62776858-62776880 GGCTTTCCATGGCTGCAATAAGG - Intronic
1122597313 14:102902541-102902563 GGCCCTGCATGGCTGCCACAGGG - Intronic
1122656078 14:103260290-103260312 GGCCCTTCATGACTGGACTCAGG - Intergenic
1122909409 14:104819743-104819765 GGCCCTACATGGCTGGCCTCCGG - Intergenic
1122974100 14:105164026-105164048 GGCCCTCCTGGGCTGCTCCATGG - Intronic
1123627841 15:22239683-22239705 GGCCCTCCTTGTCAGCACCAGGG - Intergenic
1126430085 15:48573943-48573965 GGCTCTGCAAGGCTGCACCAAGG - Intronic
1128739281 15:70072557-70072579 CACCCTCCAGGGCTGCACCAGGG + Intronic
1129741212 15:77990500-77990522 GGCCATCCCTGGCTTCACTGTGG - Intronic
1131506791 15:93026605-93026627 GGCCCTCCATGGGAGGACTGTGG - Exonic
1132145412 15:99426309-99426331 GGTCCTCAAAGGCTGCACTATGG - Intergenic
1133152918 16:3850395-3850417 CGCCCTGCATGGCTGGAGTAGGG + Exonic
1134005679 16:10817788-10817810 GGCCCTCCATGGCTGCACTAAGG + Intronic
1134866746 16:17613784-17613806 AGCCCTCGAGGGCTGCTCTATGG + Intergenic
1135938594 16:26801716-26801738 GGCCATCCATGGCTGTGGTAAGG - Intergenic
1135953011 16:26932872-26932894 GACTATCCATGGCTGGACTAAGG + Intergenic
1136286645 16:29248133-29248155 GGGGCCCCATGGCTGCACCAAGG - Intergenic
1136537901 16:30911075-30911097 GGGCCCCCAGGGATGCACTATGG - Intergenic
1142092241 16:88220766-88220788 GGGGCCCCATGGCTGCACCAAGG - Intergenic
1145384901 17:22405984-22406006 GGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1146619102 17:34382798-34382820 GGCGCTGCATGGCTGAACTGGGG - Intergenic
1147968550 17:44207207-44207229 GGCTCTCCCTGGCTGCCCTGGGG + Exonic
1148834792 17:50460390-50460412 GGCTCTCCCAGGCTTCACTATGG + Intronic
1149808784 17:59646121-59646143 GTCCCTATATGTCTGCACTATGG + Intronic
1151942093 17:77299200-77299222 GGGCCTCCAGAGATGCACTAAGG - Intronic
1152435627 17:80274531-80274553 GGCACTCCATGGTTGGGCTATGG + Intronic
1152584353 17:81182364-81182386 GGCTCTCCATGGCTGCCCTGAGG + Intergenic
1153966465 18:10187285-10187307 GGCCCTCTAAGGCTGAATTAGGG + Intergenic
1156920122 18:42512002-42512024 GGCCTTCCAAGGATGCAATATGG + Intergenic
1157134760 18:45042920-45042942 AGACCTCCTTGGCTGCACCAGGG - Intronic
1157787164 18:50494375-50494397 GGCCCTGCATGGCTGACCTCTGG - Intergenic
1160169952 18:76544748-76544770 GGCCCTCCAGGCCTGCTCTCAGG - Intergenic
1165406316 19:35633221-35633243 TGGGCTCCATGGCTGCACTGAGG + Exonic
1167049885 19:47071900-47071922 GGCCCTCCAATGATGCCCTACGG - Exonic
1167694875 19:51009462-51009484 GCCCCTTCACGGCTGTACTAAGG - Intronic
927267198 2:21163473-21163495 GGTCCTACCTGGCTGCACTAGGG + Intergenic
929442361 2:41974041-41974063 GGCCCTCCCTGGGTGATCTATGG - Intergenic
937292627 2:120790736-120790758 AGCCTGCCATGGCTTCACTAGGG - Intronic
937869937 2:126779505-126779527 GGCCCTCCAAGTCTGCACTCTGG - Intergenic
947715916 2:232338760-232338782 GGCTCTCCATGGGTCCACTGGGG + Intronic
1168854073 20:996769-996791 GGCCCTCCATGACGGGACTCTGG + Intronic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1185116849 22:48942731-48942753 GGCCCTCCAAGCCTGCAGGACGG - Intergenic
949546873 3:5080177-5080199 GGCTCTCCCTGGCTGCCCCAGGG + Intergenic
950739923 3:15042194-15042216 GGCCCTCCAGGGCAGCATTGTGG + Intronic
960333537 3:116391343-116391365 GGTCCTGCCTGGCTGCACAAGGG - Intronic
964007777 3:151852119-151852141 AGCCCTCCCTGGCTCCACCAGGG + Intergenic
969628992 4:8324416-8324438 GCCCCACCATGGCTCCACTCTGG + Intergenic
969851744 4:9963017-9963039 GGCCCTCTCTCGCTGCATTAGGG + Intronic
970017667 4:11531014-11531036 GGGCTTCCAAGGCTGGACTATGG + Intergenic
981081956 4:140644934-140644956 GGACCTCCATCTCTGCACTAGGG - Intronic
985566625 5:621669-621691 GGCCCCGCATGGCTCCACGATGG - Intronic
985802398 5:2013346-2013368 GGTCCTCCATGGATGCACACAGG - Intergenic
989362237 5:40615509-40615531 GGCCCTCCGAGGCTAGACTATGG - Intergenic
995286485 5:110394851-110394873 GGCCCTCTATGCCTCCAATAGGG + Intronic
996850248 5:127943431-127943453 GGCCCTTCATGACTGCAACAGGG - Intergenic
1000288479 5:159847767-159847789 GGCCCTCGATGAATGCACTGAGG + Intergenic
1002691796 5:181055079-181055101 GGCCCTCAGTGCCTGCACTTAGG + Intronic
1003159225 6:3621077-3621099 TGCCCTCCATGGGTTCCCTAGGG + Intergenic
1005383097 6:25257557-25257579 GGCCCTGCCTGGCTGCCCTGTGG - Intergenic
1008584573 6:52937084-52937106 GGACCTCCATGGCAGCAGCAGGG + Intergenic
1013693045 6:112667875-112667897 GGCCCTCCCTGGCTGAAATATGG - Intergenic
1016343436 6:143086135-143086157 GGCCATCCATGGCTGAGATAAGG + Intronic
1018239664 6:161760698-161760720 CCCCGTCCATGGCTGAACTAAGG + Intronic
1018376745 6:163219916-163219938 GGCCTCCCCTGGCTGCCCTATGG + Intronic
1019659622 7:2216867-2216889 GGCCTTCCTGGGCTGCACCAGGG + Intronic
1024457794 7:49629053-49629075 GCCCACCCATGGCTGCAGTAGGG - Intergenic
1029117511 7:98244848-98244870 GACCCTCCATGACTGCCCTGTGG - Intronic
1029599625 7:101556078-101556100 TGCCCACCATGGCTATACTAGGG - Intronic
1034934640 7:155190932-155190954 GGACCTTCATGGTTCCACTAGGG + Intergenic
1035034719 7:155887244-155887266 GTCCTGCCATGGCTGCACTGTGG + Intergenic
1035265265 7:157686557-157686579 GACCCCCCAAGGCTGCACCACGG + Intronic
1036494334 8:9255760-9255782 GGCCCTCCAGGGCTGCAAGGTGG + Intergenic
1036711020 8:11078661-11078683 GGCCCCCCATGACAGCACGAAGG + Intronic
1040499014 8:47991248-47991270 GGCTCTCTATGGCTTCACTCTGG - Intergenic
1043385939 8:79747921-79747943 GGCCCTGCTTGGCTGTACTCAGG + Intergenic
1047214117 8:122863097-122863119 GGCCCTTCATGGTTGCATTTTGG - Intronic
1050907203 9:11019244-11019266 GGGCCTACATGGATGCAATAAGG - Intergenic
1051206966 9:14698225-14698247 GGGCGTCTATGGCTGAACTAGGG + Intergenic
1053297271 9:36923802-36923824 GACCCTCCATCCCTGCACTGAGG - Intronic
1055986912 9:82062069-82062091 GGCCCACCATGGCTTCATTCCGG + Intergenic
1056260621 9:84844303-84844325 AACCATCCATGGCTGGACTAAGG - Intronic
1056584480 9:87919496-87919518 GGCCCACCATGGCTTCATTCCGG - Intergenic
1056612386 9:88133424-88133446 GGCCCACCATGGCTTCATTCCGG + Intergenic
1057160265 9:92884145-92884167 GGCCCACCATGGCTTCATTCCGG - Intergenic
1057272073 9:93657036-93657058 GGCCCTCTGTGGATGCACTTTGG + Intronic
1058698985 9:107585519-107585541 GGGCTTCTATGGCTGGACTAGGG + Intergenic
1059994828 9:119898606-119898628 GAGCCACCTTGGCTGCACTAAGG + Intergenic
1060149506 9:121279308-121279330 GACCTACCATGGCTCCACTATGG - Intronic
1060732234 9:126046129-126046151 GGCCACCCAGGGCTGCACTTGGG + Intergenic
1061888606 9:133605942-133605964 GACCCTCTCTGGCTGCACCATGG - Intergenic
1062131327 9:134895137-134895159 GGCCCTGCATTGCAGCACAAGGG + Intergenic
1191033157 X:55997122-55997144 GTCCCTGCCTGGCTGCACCAGGG - Intergenic
1192180802 X:68914510-68914532 GGCCTACCAGGGCTTCACTATGG + Intergenic
1198059299 X:133028435-133028457 AGCCTTCCATGGCTGCATGAAGG + Intronic