ID: 1134006578

View in Genome Browser
Species Human (GRCh38)
Location 16:10822237-10822259
Sequence GCCAAGACCAGTGTGGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134006578_1134006586 -6 Left 1134006578 16:10822237-10822259 CCCCTACCCACACTGGTCTTGGC No data
Right 1134006586 16:10822254-10822276 CTTGGCCCCTGAAGGATTTGGGG No data
1134006578_1134006585 -7 Left 1134006578 16:10822237-10822259 CCCCTACCCACACTGGTCTTGGC No data
Right 1134006585 16:10822253-10822275 TCTTGGCCCCTGAAGGATTTGGG No data
1134006578_1134006584 -8 Left 1134006578 16:10822237-10822259 CCCCTACCCACACTGGTCTTGGC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134006578 Original CRISPR GCCAAGACCAGTGTGGGTAG GGG (reversed) Intergenic
No off target data available for this crispr