ID: 1134006584

View in Genome Browser
Species Human (GRCh38)
Location 16:10822252-10822274
Sequence GTCTTGGCCCCTGAAGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134006573_1134006584 -2 Left 1134006573 16:10822231-10822253 CCCCTCCCCCTACCCACACTGGT No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006567_1134006584 26 Left 1134006567 16:10822203-10822225 CCCGACCTTTGGGAAACACTGGC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006579_1134006584 -9 Left 1134006579 16:10822238-10822260 CCCTACCCACACTGGTCTTGGCC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006570_1134006584 4 Left 1134006570 16:10822225-10822247 CCCTCTCCCCTCCCCCTACCCAC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006576_1134006584 -7 Left 1134006576 16:10822236-10822258 CCCCCTACCCACACTGGTCTTGG No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006569_1134006584 21 Left 1134006569 16:10822208-10822230 CCTTTGGGAAACACTGGCCCTCT No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006574_1134006584 -3 Left 1134006574 16:10822232-10822254 CCCTCCCCCTACCCACACTGGTC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006578_1134006584 -8 Left 1134006578 16:10822237-10822259 CCCCTACCCACACTGGTCTTGGC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006571_1134006584 3 Left 1134006571 16:10822226-10822248 CCTCTCCCCTCCCCCTACCCACA No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006575_1134006584 -4 Left 1134006575 16:10822233-10822255 CCTCCCCCTACCCACACTGGTCT No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006568_1134006584 25 Left 1134006568 16:10822204-10822226 CCGACCTTTGGGAAACACTGGCC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data
1134006580_1134006584 -10 Left 1134006580 16:10822239-10822261 CCTACCCACACTGGTCTTGGCCC No data
Right 1134006584 16:10822252-10822274 GTCTTGGCCCCTGAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134006584 Original CRISPR GTCTTGGCCCCTGAAGGATT TGG Intergenic
No off target data available for this crispr