ID: 1134008320

View in Genome Browser
Species Human (GRCh38)
Location 16:10833197-10833219
Sequence GAGGAGCCCCTGGGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134008314_1134008320 9 Left 1134008314 16:10833165-10833187 CCTATCAGCATCAACTCACTTAC No data
Right 1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG No data
1134008313_1134008320 16 Left 1134008313 16:10833158-10833180 CCTCATACCTATCAGCATCAACT No data
Right 1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG No data
1134008312_1134008320 17 Left 1134008312 16:10833157-10833179 CCCTCATACCTATCAGCATCAAC No data
Right 1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134008320 Original CRISPR GAGGAGCCCCTGGGAGAAAC AGG Intergenic
No off target data available for this crispr