ID: 1134011048

View in Genome Browser
Species Human (GRCh38)
Location 16:10853385-10853407
Sequence TCATCCTCCGTGGCAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134011048_1134011052 -10 Left 1134011048 16:10853385-10853407 CCTGTAGCTGCCACGGAGGATGA No data
Right 1134011052 16:10853398-10853420 CGGAGGATGACGGTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134011048 Original CRISPR TCATCCTCCGTGGCAGCTAC AGG (reversed) Intergenic
No off target data available for this crispr