ID: 1134012742

View in Genome Browser
Species Human (GRCh38)
Location 16:10867305-10867327
Sequence AGAGCCCACTGTGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134012739_1134012742 -3 Left 1134012739 16:10867285-10867307 CCAGAGAAAAAGCTGAAAGCAGA No data
Right 1134012742 16:10867305-10867327 AGAGCCCACTGTGTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134012742 Original CRISPR AGAGCCCACTGTGTGTGTTG GGG Intergenic
No off target data available for this crispr