ID: 1134016024

View in Genome Browser
Species Human (GRCh38)
Location 16:10889051-10889073
Sequence TCATTGCCACGGATGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134016022_1134016024 15 Left 1134016022 16:10889013-10889035 CCTGGCACTTGCTGGACACTGTG 0: 1
1: 1
2: 6
3: 26
4: 332
Right 1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134016024 Original CRISPR TCATTGCCACGGATGAAGAG AGG Intronic
900501296 1:3006016-3006038 TCTTTGGCAAGGATGCAGAGAGG + Intergenic
904377723 1:30092286-30092308 TCATTCTCCCGGATGAAGACAGG - Intergenic
917221668 1:172737139-172737161 ACATTGTCAGGGAGGAAGAGAGG - Intergenic
918010991 1:180586303-180586325 TCAGTGCCAAGGAGGCAGAGAGG + Intergenic
924025197 1:239824953-239824975 TGATTGCCACTGATGAAGATGGG - Intronic
1067839582 10:49665216-49665238 TGATTCCCATGCATGAAGAGGGG - Intergenic
1073999780 10:109359107-109359129 TCATTGCTGAGGATGAATAGGGG + Intergenic
1074120047 10:110487439-110487461 TCATTTCCAGGGAGGATGAGGGG - Intergenic
1075084017 10:119402032-119402054 TCAGTGCCACAGAGGAAGAGAGG + Intronic
1076614664 10:131747590-131747612 TCAGAGCCACGAATGAGGAGTGG + Intergenic
1083954957 11:65978028-65978050 TGAATGCCACGGATGGGGAGGGG + Intronic
1086144985 11:83541750-83541772 TCAATGCCTCTGATGATGAGTGG - Exonic
1090463867 11:126915591-126915613 TCATTGACTCACATGAAGAGTGG + Intronic
1094093948 12:26682589-26682611 CCATAGACACAGATGAAGAGAGG - Exonic
1100558887 12:95727109-95727131 TCATAGCCATGGATGTAAAGTGG + Intronic
1101277626 12:103219660-103219682 TGATGGCCAGGGATGATGAGCGG - Intergenic
1102071140 12:110020741-110020763 TCATCCCTACGGATGAACAGTGG - Intronic
1106768246 13:32937561-32937583 TCTCTACCAGGGATGAAGAGAGG + Intergenic
1119739900 14:77007617-77007639 TCCTTGGCAGGGAAGAAGAGAGG + Intergenic
1125027675 15:35046893-35046915 TTATTTCCACTTATGAAGAGAGG + Intergenic
1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG + Intronic
1139481217 16:67231784-67231806 TGATGCCCACGGAGGAAGAGCGG - Exonic
1150136416 17:62697708-62697730 TCATTGTCATGGAGGAATAGTGG - Intergenic
1152234640 17:79132354-79132376 TCACTGCCCCGGATGAGCAGCGG + Intronic
1153368499 18:4286695-4286717 TGATTGCCAAGGAACAAGAGAGG + Intronic
1154989164 18:21583711-21583733 TCATTGCCTGGGATGAAGAGTGG + Intronic
1156224585 18:35091672-35091694 TCATTGCCAAGGAGGCAAAGTGG - Intronic
1156374119 18:36497592-36497614 ATATTGACAGGGATGAAGAGAGG + Intronic
1163190432 19:15673167-15673189 TCCTGGCCTGGGATGAAGAGGGG + Intronic
1166229570 19:41418297-41418319 TCTTTGCCCCGCCTGAAGAGTGG - Intronic
925070700 2:965037-965059 TCAGGGCCAAGGATGAAGATTGG - Intronic
925664584 2:6239008-6239030 TCATTGCCACCCATGCAGAAGGG + Intergenic
931775359 2:65535821-65535843 TCATTGCCACAGATGAACTAGGG + Intergenic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
937028538 2:118719088-118719110 TCATTACCAGGGCTGGAGAGAGG + Intergenic
937235961 2:120432173-120432195 TCATTCCCACGGGTGAGGATAGG - Intergenic
942319649 2:174725289-174725311 TCATTGCAAGGGATGCAGAGTGG + Intergenic
944674729 2:202025745-202025767 TCATTACTATGGAAGAAGAGGGG + Intergenic
1169980414 20:11378414-11378436 TCATTGCCATGGAAGGAAAGGGG + Intergenic
1170503673 20:17001623-17001645 TGGTTGCCATGGATGAAGAAGGG + Intergenic
1177950847 21:27535192-27535214 TCATTCCGACAGATGAAAAGAGG + Intergenic
1178026006 21:28467950-28467972 TCATTGCAAAAGAAGAAGAGTGG + Intergenic
1178702485 21:34845311-34845333 TCCTTGCCAGGGATGGAGACAGG + Intronic
1181049897 22:20233530-20233552 TCATCACTACAGATGAAGAGAGG - Intergenic
1181061038 22:20282104-20282126 TCATTGCCATTGATGAAGTCTGG - Intronic
1181171009 22:21010077-21010099 CCATTGCCATGGATCAAGTGGGG + Intronic
1182246067 22:28958629-28958651 TGATTGCCACTGACGGAGAGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950730476 3:14952294-14952316 TCAGTGCCACGGCTGAAGACAGG - Intronic
950883724 3:16344936-16344958 TGAGAGCCACAGATGAAGAGAGG - Intronic
960626769 3:119688738-119688760 TCATTGCCAAGGAGGTTGAGGGG - Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
964360200 3:155887851-155887873 TCATTGATATAGATGAAGAGTGG + Intronic
964384403 3:156131876-156131898 GCATTGACATGGATCAAGAGAGG + Intronic
971978108 4:33717224-33717246 TTATTACCACGGGTGAAGGGAGG + Intergenic
973051425 4:45602799-45602821 TCTTTGTCATTGATGAAGAGGGG - Intergenic
977151960 4:93523693-93523715 CCACTGTCAGGGATGAAGAGGGG - Intronic
986735338 5:10663682-10663704 TCATTGCCAGAGACGCAGAGGGG - Intergenic
988784180 5:34550604-34550626 TCCTTGTCATGGATGAGGAGGGG + Intergenic
990042135 5:51388533-51388555 TCATTCCCAAGGAAGAGGAGTGG + Intronic
991417875 5:66410363-66410385 TCATAGCAAGGGCTGAAGAGAGG + Intergenic
992318621 5:75587016-75587038 TCATTTCAAGGGATGGAGAGAGG + Exonic
999893729 5:156006475-156006497 TCATTTCCTGGGAGGAAGAGAGG - Intronic
1001137712 5:169116305-169116327 TGGTTCCCACGGAAGAAGAGTGG + Intronic
1001888554 5:175318852-175318874 TAGTTGCCACGGATGAGGACAGG + Intergenic
1004384551 6:15161438-15161460 TCATAGCAAAGGATGGAGAGCGG + Intergenic
1006805901 6:36788911-36788933 TCATCCCCATGGATGAAGAGAGG + Intronic
1013434968 6:110094706-110094728 TCACTGCCATGGATGGAGGGAGG - Intergenic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014952483 6:127573363-127573385 TCATGGCCACACATGTAGAGTGG - Intronic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1028179717 7:87704793-87704815 TCATTGCAATGAATAAAGAGAGG - Intronic
1030829752 7:114206640-114206662 TCATTCCAACAGAGGAAGAGAGG - Intronic
1031037557 7:116804562-116804584 TCAGTTCCACTGATGCAGAGTGG - Intergenic
1033538601 7:142335104-142335126 TCAGTGCCACAGAGGAATAGCGG - Intergenic
1033554490 7:142476931-142476953 TCGTTGCCACAGAAGAATAGCGG - Intergenic
1035400643 7:158563130-158563152 GCAGTGCCACCGAAGAAGAGAGG + Intronic
1037868012 8:22463299-22463321 TCATTGCCATGGACAAACAGTGG - Intronic
1038387415 8:27161987-27162009 CCATGGCCAGGGCTGAAGAGAGG + Intergenic
1038422577 8:27442898-27442920 ACATTGCCATGGAGCAAGAGAGG + Exonic
1043190851 8:77221241-77221263 TCAGTGCCACGGATGACTTGTGG - Intergenic
1045706853 8:104933997-104934019 TCAGTGCCTCTTATGAAGAGCGG - Intronic
1047688528 8:127326411-127326433 ACATTGCCAGGGATAAAGAGGGG + Intergenic
1048880432 8:138868188-138868210 TCATGGCCTCCGAGGAAGAGAGG + Intronic
1049594935 8:143478975-143478997 ACATTCCCAAGCATGAAGAGCGG - Intronic
1052422654 9:28263657-28263679 TCATAGCCACGTATGTAGTGTGG + Intronic
1057528114 9:95820286-95820308 TGGTTGCCAGGGATGAGGAGTGG + Intergenic
1058135049 9:101297891-101297913 TCATTGCCACTGAAAAAGAAAGG - Intronic
1060726684 9:126010846-126010868 TCATTGCCAAGGGTGGACAGAGG + Intergenic
1185689475 X:2141643-2141665 TCATTGCTACCCATGAAGAGAGG - Intergenic
1188234023 X:27704497-27704519 TGATTGCCAGGTATGAAGAGGGG + Intronic
1189160226 X:38803530-38803552 TGGTTGCCGGGGATGAAGAGGGG - Exonic
1190797436 X:53758697-53758719 TCACAGCCACGGAAGAAGAGCGG + Intergenic
1190917704 X:54822442-54822464 TCACAGCCACGGAAGAAGAGCGG - Intergenic
1199088047 X:143651841-143651863 TCATTGCCACAAATGAAAACAGG + Intergenic