ID: 1134019804

View in Genome Browser
Species Human (GRCh38)
Location 16:10913634-10913656
Sequence GAGTTTTATTTTTAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 750}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134019804_1134019807 -7 Left 1134019804 16:10913634-10913656 CCTCACAGTTAAAAATAAAACTC 0: 1
1: 0
2: 1
3: 68
4: 750
Right 1134019807 16:10913650-10913672 AAAACTCTGGCCAGGCGCAGTGG 0: 2
1: 48
2: 392
3: 2879
4: 12236
1134019804_1134019812 24 Left 1134019804 16:10913634-10913656 CCTCACAGTTAAAAATAAAACTC 0: 1
1: 0
2: 1
3: 68
4: 750
Right 1134019812 16:10913681-10913703 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1134019804_1134019814 30 Left 1134019804 16:10913634-10913656 CCTCACAGTTAAAAATAAAACTC 0: 1
1: 0
2: 1
3: 68
4: 750
Right 1134019814 16:10913687-10913709 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1134019804_1134019810 21 Left 1134019804 16:10913634-10913656 CCTCACAGTTAAAAATAAAACTC 0: 1
1: 0
2: 1
3: 68
4: 750
Right 1134019810 16:10913678-10913700 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1134019804_1134019809 20 Left 1134019804 16:10913634-10913656 CCTCACAGTTAAAAATAAAACTC 0: 1
1: 0
2: 1
3: 68
4: 750
Right 1134019809 16:10913677-10913699 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134019804 Original CRISPR GAGTTTTATTTTTAACTGTG AGG (reversed) Intronic
900194955 1:1371407-1371429 GGGTTTTATTTTTATCTCTGCGG - Intergenic
900945301 1:5827940-5827962 GAGTTTTGCTTAGAACTGTGTGG - Intergenic
901361050 1:8700912-8700934 GAGATTTATTTTTGATTTTGAGG - Intronic
901752749 1:11421519-11421541 GAGTTTTATTACCACCTGTGAGG + Intergenic
902057913 1:13617810-13617832 GACTGTTATTTTTCACAGTGAGG - Exonic
902656403 1:17871910-17871932 GAGTTTTAGTTCTAACTTTCAGG + Intergenic
902846681 1:19116339-19116361 GGGTTTGATTTTTCATTGTGTGG - Intronic
903159672 1:21477502-21477524 TAGTTTTCCTTTTAACAGTGAGG + Intronic
904159050 1:28508913-28508935 GATTTTTTTTTTTAACAGGGAGG + Intronic
906275010 1:44508856-44508878 GAGTCTTCTTTTAATCTGTGGGG + Intronic
906685889 1:47762983-47763005 GACTTTTCTGTTTGACTGTGAGG - Exonic
906714565 1:47957144-47957166 GAGTTTTCTTTCTAACAGTCAGG - Intronic
907456159 1:54576937-54576959 GAGTTTTATTATTAGATGTCTGG - Intronic
907599458 1:55752159-55752181 GAGTTTTGCTTTTACCTTTGTGG + Intergenic
908938829 1:69408822-69408844 ATGTTTTATTTTTGTCTGTGTGG + Intergenic
909492927 1:76245812-76245834 GAGTTTTATTTCAAATTATGTGG + Intronic
909727043 1:78848852-78848874 GAGTTTTACTTCCAACTATGTGG + Intergenic
910383848 1:86660183-86660205 GTGTTTTACTTCTAACTATGTGG - Intergenic
910501662 1:87899075-87899097 GAGCTTTGTGTGTAACTGTGTGG - Intergenic
910997335 1:93120780-93120802 GAATTTTATTTTTAGTTCTGGGG + Intronic
911462534 1:98208826-98208848 TTGTTTTATTTTTAATTTTGTGG - Intergenic
911530956 1:99042313-99042335 GAGTTTTACTTCTAATTATGTGG - Intergenic
911932621 1:103924077-103924099 GAGCTTTACTTCCAACTGTGTGG - Intergenic
912836430 1:113000660-113000682 GAGGTTTATTTTTTACAGTCTGG + Intergenic
913017231 1:114751503-114751525 GAGTTTTTATTTTACATGTGAGG - Intronic
913152126 1:116054642-116054664 GAGCTTTATTTCCAACTATGTGG - Intronic
913434652 1:118834158-118834180 GAGCTTTATTTCCAACTATGTGG - Intergenic
916245054 1:162678974-162678996 CAGTTATATTTTTGACAGTGTGG + Intronic
916711717 1:167416505-167416527 GACTTCTGTTCTTAACTGTGGGG + Exonic
916898025 1:169187161-169187183 GTGTTTTATGTATAACTATGTGG + Intronic
917180158 1:172287346-172287368 GAATTTTGGTTATAACTGTGGGG - Intronic
917419332 1:174846632-174846654 GAGTTTTACTTCCAACTATGTGG + Intronic
917533634 1:175858383-175858405 GGGTTTTTTTTTTAATTGTATGG + Intergenic
917711900 1:177693443-177693465 TAGTTTTCCTTTTAACAGTGAGG - Intergenic
917718519 1:177762116-177762138 GAGCTTTACTTCCAACTGTGTGG - Intergenic
918081894 1:181214233-181214255 GTGTTTTATTTTTAAATGAGAGG - Intergenic
918422306 1:184376602-184376624 GCTTTTTTTTTTTAATTGTGAGG - Intergenic
919161765 1:193839670-193839692 GGTTTTTATTTTAAACTGTCTGG - Intergenic
919532145 1:198736035-198736057 GAATTTTATTTTTAATTTTTTGG + Intronic
920529745 1:206693226-206693248 CAGGTTTATTTTTAGCTGTTCGG - Intronic
920900194 1:210102542-210102564 AAGTTTTAATATTAACTTTGTGG + Intronic
920981547 1:210841058-210841080 GAGTTGTTTTTTTAAGTATGAGG - Intronic
921288226 1:213628988-213629010 GAGCTTTACTTCCAACTGTGTGG + Intergenic
921570440 1:216771792-216771814 TATTTTTATTTTTAAGTTTGTGG + Intronic
921641595 1:217561218-217561240 GAGTTGTAATTTTAAATGTCTGG - Intronic
921887079 1:220317696-220317718 GAGTTTTCTTTCTACCTCTGTGG - Intergenic
922409783 1:225360896-225360918 GAGTTTTACATTTATCTGTAAGG + Intronic
922687962 1:227662388-227662410 AAGTTTTATTTTTTTCTGTTTGG + Exonic
922949455 1:229546409-229546431 TACTTTGATTTTTGACTGTGTGG + Intronic
923254078 1:232204763-232204785 CAGTTTTATTTATACCTGTCAGG - Intergenic
923683986 1:236141899-236141921 AAGTTTTATTTTTAAAGGGGGGG + Intergenic
923785193 1:237059974-237059996 GAGTCTTATTAATAACTATGTGG - Intronic
924526791 1:244859694-244859716 AAATTTTATTTTTAACTCTTTGG + Intronic
924568349 1:245216471-245216493 CAGTTTTATTTTTAATAGTTTGG - Intronic
1063143043 10:3272945-3272967 TAGTGTTATTTTTGCCTGTGGGG - Intergenic
1063324717 10:5086481-5086503 GAGCTTTACTTCTAACTATGTGG + Intronic
1063361028 10:5458992-5459014 GGGTCTTATTTTTACCTTTGAGG - Intergenic
1063623592 10:7669208-7669230 GAGTTTTATTTTCATCTGGGAGG + Intergenic
1063811525 10:9714430-9714452 GAGTTGTATTTTGAATAGTGAGG + Intergenic
1064579229 10:16777256-16777278 GAGTTTTTTTTTTTAATCTGTGG - Intronic
1065567059 10:27022450-27022472 GATTTTTTTTTTTAACTTTAGGG - Intronic
1065583026 10:27190702-27190724 GAGTCATTCTTTTAACTGTGTGG + Intergenic
1065890507 10:30117283-30117305 GATTTTTATTTTTAAATGGGTGG + Intergenic
1065930928 10:30478482-30478504 GATCTTTAGTTTTAAATGTGGGG - Intergenic
1066516870 10:36172224-36172246 GGTTTTTTTTTTTAAATGTGTGG - Intergenic
1067345732 10:45437758-45437780 GGGTTTTAGTTTAGACTGTGAGG + Intronic
1068078521 10:52289297-52289319 GACTTTTATTTGTAATTCTGTGG - Intronic
1068107293 10:52634701-52634723 AAGGTTTATTTTTAATAGTGGGG - Intergenic
1068294291 10:55048670-55048692 GAGTTTTAATTTTAAATCAGTGG + Intronic
1068776904 10:60877589-60877611 TAGTTTTATTTCAAACTCTGGGG + Intronic
1069018484 10:63459443-63459465 GAAATTTCTATTTAACTGTGAGG + Intronic
1069152349 10:64979442-64979464 AAGTTTTGTCTTTAAATGTGTGG - Intergenic
1069197020 10:65563618-65563640 GGGTTTTATTTTTTATTGTTGGG - Intergenic
1069250569 10:66261211-66261233 GAATTTTATTTTAAACTGAAGGG + Intronic
1070030607 10:72673590-72673612 TATTTTTATTTTTACCTTTGAGG + Intergenic
1070209663 10:74302905-74302927 CAGTTTTATTTTAAATTCTGTGG + Intronic
1072334728 10:94387890-94387912 GACTTTTTGTTTTAAATGTGGGG - Intergenic
1072992647 10:100212185-100212207 TAGTTCTATTTTTAATTTTGAGG + Intronic
1073480542 10:103783812-103783834 GAGGTTTATTTTTAGCTCTAGGG - Intronic
1073859025 10:107715360-107715382 GAGATTTATTTTTATCTGTATGG - Intergenic
1073883456 10:108009396-108009418 GATTTTTATTTTTAACTTTTTGG + Intergenic
1074259466 10:111837454-111837476 GATTGTTATTTTAAAATGTGGGG + Intergenic
1074434637 10:113423876-113423898 GAGCTTTCTTTTTGCCTGTGTGG - Intergenic
1074647209 10:115471387-115471409 TAGTTTTATTTTTAATTTTTGGG + Intronic
1076298778 10:129408188-129408210 GAGTTATATTTTTGCCAGTGTGG - Intergenic
1076515102 10:131040936-131040958 GGGTTTTAGTTTAAATTGTGTGG + Intergenic
1077586182 11:3455183-3455205 GAGTTTTATTTTCTACTGGCTGG + Intergenic
1077710561 11:4532352-4532374 TAGTTTTCTTTCTAACTGTCAGG - Intergenic
1079278573 11:19066174-19066196 GTGTTTTACTTTTAATTATGTGG + Intergenic
1079480068 11:20870731-20870753 GACTTTTGTTATTAAATGTGAGG - Intronic
1079575521 11:21999253-21999275 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1079900022 11:26171512-26171534 GTGTTTTACTTCTAACTGTGTGG - Intergenic
1080356504 11:31453092-31453114 CAGCTTTATTTTTTACTGTTAGG - Intronic
1080527480 11:33140435-33140457 GTGTTTTATTTTTGTGTGTGTGG - Intronic
1080766032 11:35297500-35297522 TAGTTTTTTATTTAACAGTGTGG + Intronic
1080924389 11:36740729-36740751 GACTTTCATAATTAACTGTGAGG + Intergenic
1081789527 11:45773167-45773189 CAGGTTTTTTTTTAACTGAGGGG + Intergenic
1082210428 11:49494812-49494834 TAATTCTATTTATAACTGTGTGG + Intergenic
1083211644 11:61191228-61191250 GAGTTTTAGTTTAGATTGTGAGG - Intergenic
1085209321 11:74760716-74760738 GAGTTTTACTTCCAACTATGTGG + Intronic
1085221808 11:74880867-74880889 GAGTTTTACTTCCAACTATGTGG + Intronic
1085504178 11:77047061-77047083 GAGTTTTATTTTTTGTTGTTGGG - Intergenic
1086025665 11:82287574-82287596 TCATTTTATTTTTAATTGTGGGG + Intergenic
1086380793 11:86251054-86251076 CAGTTTGTTTTTTAAATGTGAGG + Intronic
1086639198 11:89130017-89130039 TAATTCTATTTATAACTGTGTGG - Intergenic
1087298777 11:96409032-96409054 GAGCTTTACTTCCAACTGTGTGG + Intronic
1087542986 11:99544637-99544659 GAATTTTTTTTTTATCTGTGAGG + Intronic
1087784320 11:102338017-102338039 GAGTTTTATTCTTATCTCTTTGG + Intronic
1087968807 11:104453572-104453594 AAGTTTTATCTTTAACCCTGGGG + Intergenic
1088508751 11:110553237-110553259 GTGCTTTACTTCTAACTGTGTGG + Intergenic
1088730285 11:112674894-112674916 TAGTTTTGTTTTTAGCTCTGAGG - Intergenic
1088978954 11:114843844-114843866 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1089026548 11:115276534-115276556 ATATTTTATTTTTCACTGTGAGG - Intronic
1089851895 11:121504803-121504825 AAGTATGATTTTTAACTGTGAGG + Intronic
1089889169 11:121862198-121862220 GGGTTTTTTTTTTAAGAGTGAGG + Intergenic
1090051348 11:123382570-123382592 GAGTGTGATATTTAAGTGTGTGG + Intergenic
1090585769 11:128210869-128210891 AAGTTTTATTTTTATATCTGTGG - Intergenic
1090607337 11:128434896-128434918 GAGTAATATTTTAAACTGTGGGG + Intergenic
1091622511 12:2100090-2100112 TAGTGTTATTTTTAAGTGTCAGG - Intronic
1091651060 12:2310333-2310355 TATTTTTTTTTTTAACTGGGAGG - Intronic
1091982003 12:4872248-4872270 TAGTTTTAGTTTTAATTGTTAGG - Intergenic
1092030158 12:5277166-5277188 GAGTTTTAAATATAACTATGTGG + Intergenic
1092575640 12:9779783-9779805 TTGTTTTATGTTCAACTGTGTGG + Intergenic
1093239860 12:16657032-16657054 TTGTTTTATGTTTAATTGTGTGG + Intergenic
1093804822 12:23419003-23419025 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1093881633 12:24410435-24410457 GAGTTTTACATTTAAGTCTGTGG + Intergenic
1094446278 12:30534072-30534094 GAGTTTTATGTTGAACTGGTTGG - Intergenic
1095752060 12:45724092-45724114 GAATTTTAAATTTAACTCTGTGG + Intergenic
1096917663 12:55050648-55050670 AAGTTTTCTGTATAACTGTGTGG + Intergenic
1097290455 12:57910175-57910197 GAACTTTATTTTTAACTGGGAGG + Intergenic
1097455505 12:59794450-59794472 TAGTTTTATTTAGAAGTGTGTGG + Intergenic
1097483646 12:60164758-60164780 TTGTTTGATTTTAAACTGTGTGG + Intergenic
1097525052 12:60723290-60723312 TAGTTTTATTGTTAATTTTGAGG + Intergenic
1098110450 12:67116087-67116109 GATTTTTATTATTACCTGTTTGG + Intergenic
1098248320 12:68543252-68543274 GAGCTTTTGTTTTAAATGTGGGG - Intergenic
1098372123 12:69770701-69770723 AAGTTTGATTTTTAACTGACAGG + Intronic
1098455538 12:70668790-70668812 AATTTTTATTTTTAATTTTGTGG - Intronic
1098728774 12:74005292-74005314 GAGTGTGATCTTTAACTCTGTGG + Intergenic
1099160696 12:79238092-79238114 GAGTTTTGTGGTTAACAGTGAGG + Intronic
1099460373 12:82913836-82913858 GGGATTTGTTTTTAAGTGTGTGG - Intronic
1099529058 12:83753100-83753122 GTGCTTTATTTTTACCTGTCTGG + Intergenic
1100058246 12:90539204-90539226 GAGTTTTACTTCCAACTATGTGG - Intergenic
1100074591 12:90764615-90764637 GGGTTTTTTTTTTCCCTGTGTGG + Intergenic
1100331149 12:93583370-93583392 GAGCTTTATTTTCATCTGTCAGG + Intronic
1100463523 12:94823713-94823735 TAGTTTTCTTTCTAACAGTGAGG - Intergenic
1100624211 12:96313979-96314001 TTGTTTTATTTTTAACATTGGGG - Intronic
1100740307 12:97584120-97584142 GTGTTTTACTTTCAATTGTGTGG - Intergenic
1100901046 12:99240633-99240655 GTGTTTTACTTCTAACTATGTGG - Intronic
1100965040 12:100003798-100003820 CCATTTTATTTTAAACTGTGTGG - Intergenic
1101100650 12:101388779-101388801 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1101188921 12:102311170-102311192 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1101286377 12:103317480-103317502 ATGTTTTATTTTTAAATGTCTGG + Intronic
1104012075 12:124938881-124938903 GGGTTTTAGTTTAAATTGTGAGG + Intergenic
1105732975 13:23237749-23237771 AAGTTTTATGTTCCACTGTGTGG - Intronic
1106455767 13:29925216-29925238 AAGTTTTATTTTCAGCTGTGGGG - Intergenic
1106831582 13:33589704-33589726 GTGCTTTATTTTCAACTATGTGG + Intergenic
1107053912 13:36082462-36082484 TACATATATTTTTAACTGTGTGG + Intronic
1107669984 13:42735365-42735387 GAGGTGTCTTTTTACCTGTGCGG - Intergenic
1108143706 13:47453879-47453901 GTGTTTTATTTTTTCCTGTAAGG + Intergenic
1108564138 13:51677915-51677937 GCCTTTTATTTTTTCCTGTGAGG + Intronic
1108578483 13:51809212-51809234 CAATTTTATTTTTAATTTTGGGG + Intergenic
1108756275 13:53506098-53506120 GAGTTTTAATTTTCACTTTGGGG + Intergenic
1109042170 13:57353148-57353170 GAGTTATATTTTTCAGTGAGTGG - Intergenic
1109139856 13:58701466-58701488 TATTTTTATTTTTAATTATGAGG + Intergenic
1109532878 13:63675672-63675694 GTATTTTATTTTTAAATTTGTGG - Intergenic
1109707353 13:66113608-66113630 GGGTTTTAGTTTTGACTATGGGG + Intergenic
1109913249 13:68944549-68944571 TAGTGTTATTTTTATCTGTTTGG - Intergenic
1110282356 13:73709744-73709766 GACATTTAGATTTAACTGTGAGG + Intronic
1110498320 13:76195413-76195435 GAGTATTATGTTCAATTGTGTGG + Intergenic
1110730542 13:78875216-78875238 TAATTTACTTTTTAACTGTGAGG + Intergenic
1110894399 13:80731265-80731287 GCATTTTATTTTTAACTTTTAGG + Intergenic
1110920156 13:81074301-81074323 GAATTTTATTTTTTAATGTAAGG + Intergenic
1111023582 13:82488318-82488340 GTGTTTTTTTTTTAATTGTAAGG + Intergenic
1111024760 13:82505393-82505415 GAGTTTTATTTTGTTCTCTGGGG + Intergenic
1111429070 13:88128554-88128576 GAGTTTTTTTTTTAATTTAGAGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112220410 13:97483870-97483892 GTGTTTTAATTTTAACTTTATGG + Intergenic
1112658882 13:101484184-101484206 AAGTTTTATTTTTATTTTTGTGG + Intronic
1112819883 13:103320198-103320220 GAGTTTTAGTTGAAACTCTGTGG + Intergenic
1113157904 13:107346224-107346246 GAGTTCTATCTTTAATTTTGAGG - Intronic
1113162974 13:107403713-107403735 GAGTTTTTTTTTAAAATTTGTGG - Intronic
1113223004 13:108126912-108126934 GAGTTTAATATTTCAATGTGTGG - Intergenic
1115014361 14:28591935-28591957 GAGTCTTATTTTTAAGTTTTAGG - Intergenic
1115331098 14:32199370-32199392 GTGTTTTATTTATATCTGTGTGG - Intergenic
1115828753 14:37310408-37310430 AAGTTATCTTTTTAACTGGGAGG - Intronic
1115881470 14:37923833-37923855 GAGATCTATGTTTAACTCTGGGG + Intronic
1116094179 14:40347619-40347641 AGGTTATATTTTTAACAGTGTGG + Intergenic
1116157957 14:41232492-41232514 GAGGTTAATTTTTACTTGTGTGG - Intergenic
1116566753 14:46455503-46455525 TAGTTCTATTTTTAACTTTTAGG + Intergenic
1116742346 14:48772790-48772812 TATTATTATTTTTAAGTGTGTGG + Intergenic
1117086930 14:52210865-52210887 GTGCTTTATTTTCAACTATGTGG - Intergenic
1117664509 14:58042185-58042207 GTGTTTTATTTCCAACTATGTGG - Intronic
1117740982 14:58819190-58819212 GATTTTTATTTTTATTTTTGGGG + Intergenic
1118291744 14:64531835-64531857 GAGTTTTGTCTTTTTCTGTGTGG + Intronic
1118414244 14:65516567-65516589 GAGTTTTATATTTAAGTATCTGG - Intronic
1118511911 14:66484445-66484467 GTTTCTTTTTTTTAACTGTGAGG + Intergenic
1118925468 14:70187439-70187461 GTATTTTATTTTTAACGGTGTGG - Intronic
1120137931 14:80892047-80892069 GATTTTTTTTTTTTCCTGTGAGG - Intronic
1120299980 14:82693363-82693385 GAATTTAATTTTTAACTTTATGG + Intergenic
1120540722 14:85747450-85747472 TAGTTCTATTTTTAATTGTTGGG + Intergenic
1120603826 14:86546555-86546577 GAGATTTAATTTAAACAGTGTGG - Intergenic
1122150612 14:99724271-99724293 CCTTTTTATTTTTACCTGTGAGG + Intronic
1123691006 15:22838390-22838412 GAGTTTGATTTTGAACTGATCGG + Intergenic
1124450384 15:29783422-29783444 TAGTTTTCTTTTTAGCTCTGAGG - Intronic
1124464055 15:29920249-29920271 GGGCTTTATTTTTACCTGTATGG - Intronic
1125290383 15:38140103-38140125 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1125393382 15:39220993-39221015 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1125776364 15:42218955-42218977 TAGTTCTATTTTTAATTTTGAGG + Intronic
1125989430 15:44091787-44091809 GAATTTTTTTTTTAACTGACAGG + Intronic
1126395108 15:48206707-48206729 GAGGTTTATATTTGACTGTGAGG - Intronic
1127218403 15:56849525-56849547 GAGTTTTATCTATATCTGTCAGG - Intronic
1127279523 15:57477120-57477142 GCCTTTTATTTCTAACTGTAAGG - Intronic
1127760135 15:62131613-62131635 AAGTTTTAGTTTGAACAGTGGGG + Intergenic
1128014352 15:64329260-64329282 GAGTTTTACTTCCAACTATGTGG - Intronic
1128626308 15:69208887-69208909 CGGTATTATTTTTAAATGTGAGG + Intronic
1129964387 15:79721001-79721023 GAGACTGATTTTGAACTGTGTGG - Intergenic
1130433288 15:83871148-83871170 AAGTTTGTTTTTTAACTGTTAGG - Intronic
1130837504 15:87665055-87665077 GAGTCTTATTTTTCAGTGAGGGG - Intergenic
1131422842 15:92321610-92321632 GAGGTTTATTTTGAAATGTTTGG + Intergenic
1131916199 15:97268984-97269006 GAGTTTTACTTCCAACTGTGTGG + Intergenic
1132013682 15:98297878-98297900 GATTTTTATATTTACGTGTGGGG - Intergenic
1133721654 16:8499859-8499881 GTGATTGTTTTTTAACTGTGTGG + Intergenic
1134019804 16:10913634-10913656 GAGTTTTATTTTTAACTGTGAGG - Intronic
1134019857 16:10913980-10914002 GAGTTTTTTTTTTAACCATGAGG - Intronic
1134116191 16:11550547-11550569 GAGTATTATTTTCAAATCTGGGG + Intronic
1136727215 16:32369266-32369288 GTGTTTTACTTCTAACTATGTGG + Intergenic
1136908682 16:34127725-34127747 GTGTTTTACTTTCAACTATGTGG + Intergenic
1136991654 16:35155071-35155093 TAGTTTTATATTTAACTCTTTGG - Intergenic
1137354035 16:47741380-47741402 GTCATTTATATTTAACTGTGTGG + Intergenic
1138379680 16:56591157-56591179 GGGTTTCACTCTTAACTGTGTGG - Intergenic
1138729697 16:59181782-59181804 TTGTTTTATTTTTATCTCTGTGG + Intergenic
1139070590 16:63376772-63376794 TTGTTTTATTTTTAATTCTGTGG - Intergenic
1139260828 16:65591924-65591946 AGGTTATATTTTTAAATGTGCGG + Intergenic
1139398939 16:66664643-66664665 TAGTTTTTTTTTTAAGTGTTTGG - Intronic
1140308601 16:73827809-73827831 GAGTTTTACTTCCAACTATGTGG + Intergenic
1202999218 16_KI270728v1_random:148482-148504 GTGTTTTACTTCTAACTATGTGG - Intergenic
1203130816 16_KI270728v1_random:1684892-1684914 GTGTTTTACTTCTAACTATGTGG - Intergenic
1142730959 17:1857217-1857239 GTGTTTAGTTTTTAAATGTGGGG + Intronic
1142897286 17:2989664-2989686 GATTTTTTTTTTTAACTGTTGGG + Intronic
1143674306 17:8420320-8420342 GTGTTTTATTTTTTATTTTGGGG - Intronic
1143914115 17:10276180-10276202 GAGTATTATTTTTGCCTCTGGGG + Intergenic
1144384305 17:14735371-14735393 TAATTTTATTTTTTACTTTGTGG - Intergenic
1145727121 17:27140207-27140229 GAGTTTTTTTTTAATCTGTAAGG + Intergenic
1146981543 17:37166437-37166459 AAGTGTTATTTTTAAAAGTGAGG - Intronic
1147329409 17:39688121-39688143 GAACTTTAATTTAAACTGTGTGG - Intronic
1147525595 17:41219240-41219262 ATGTTTTATTTTTAATTATGTGG - Intronic
1148367452 17:47067083-47067105 GATTTTTTGTTTTAAATGTGGGG + Intergenic
1148494665 17:48046171-48046193 CAGTTTTAGTTTGAACTGTTAGG + Intergenic
1148899928 17:50867469-50867491 GAGTAATATTTTTAGCTGAGAGG - Intronic
1149179321 17:53915465-53915487 GAGTTTTACTTCCAACTATGTGG - Intergenic
1151209271 17:72532246-72532268 GGTTTTTTTTTTTAACTTTGAGG + Intergenic
1153059046 18:976987-977009 GTGTTTTACTTTTAATTATGCGG + Intergenic
1153064670 18:1032713-1032735 GTGTTTTACTTTTAATTATGTGG + Intergenic
1153682438 18:7513287-7513309 GAGTTATATTTGTAGCTGGGGGG - Intergenic
1153830305 18:8916694-8916716 GACTTTTTGTTTTAAATGTGGGG - Intergenic
1155305520 18:24474378-24474400 AAGTTTTCTTTTTAACTGTAGGG - Intronic
1155455108 18:26003825-26003847 GACTTTTTTTTTTAATTGAGGGG + Intergenic
1155649575 18:28124943-28124965 GAGTTATTTTTTAAACTGTGTGG + Intronic
1155659079 18:28226635-28226657 GTGCTTTACTTCTAACTGTGTGG + Intergenic
1156105186 18:33650964-33650986 TTGTTTTATTTTTACCTCTGAGG + Intronic
1156107923 18:33688374-33688396 GAGTTTTATTTTTAACATATTGG + Intronic
1156236315 18:35208379-35208401 GAGTTTTACTTCCAACTATGTGG - Intergenic
1156293245 18:35768308-35768330 CAGTTTTATTTTTAACATTTAGG + Intergenic
1156839570 18:41595207-41595229 GAGTTTCCTTTTTGCCTGTGAGG + Intergenic
1157959905 18:52141697-52141719 GATTTCTATTTTATACTGTGTGG - Intergenic
1159096877 18:63912547-63912569 GTTTTTTGTTTTTAATTGTGTGG + Intronic
1159143050 18:64420224-64420246 GAGTTTTATTTTTGTATGTCCGG - Intergenic
1159315196 18:66764162-66764184 GAGTTTAATTTTTATCTCTATGG + Intergenic
1159320343 18:66839449-66839471 AGGTTTTATATTGAACTGTGAGG - Intergenic
1159578383 18:70206810-70206832 TATTGTTATTTTCAACTGTGGGG + Intergenic
1159703448 18:71658037-71658059 GACTTTTATTTTAAAATGAGCGG + Intergenic
1159745152 18:72224787-72224809 GAGTTTTCTTTTTAATTCTCAGG + Intergenic
1161395887 19:4044701-4044723 GTGTTTTTTTTTTAACTGCCTGG - Exonic
1163073836 19:14870191-14870213 GAGTGTTATTTTTTATTGGGTGG + Intergenic
1163097025 19:15066181-15066203 GAGTTTGAGTTTTATCTGGGGGG + Intergenic
1163362070 19:16853061-16853083 AAGTTTCATTTTTTTCTGTGGGG - Exonic
1164096428 19:22013836-22013858 TAGTTTTATTTTTCAATATGTGG + Intergenic
1164101985 19:22063760-22063782 TTGTTTTATTTCTAATTGTGTGG + Intronic
1164277246 19:23731144-23731166 ATGTTTTATTCTTAACTGTGTGG - Intergenic
1165754589 19:38285177-38285199 AGGTTTTAATTTAAACTGTGAGG - Intronic
1166955551 19:46462274-46462296 ATGTTTTATTTTTTAATGTGGGG + Intergenic
1167721594 19:51183711-51183733 GAAGACTATTTTTAACTGTGTGG - Intergenic
925096706 2:1210508-1210530 GAGTCATATCTTTCACTGTGAGG - Intronic
926388418 2:12361777-12361799 GGCTTGTGTTTTTAACTGTGAGG + Intergenic
926793240 2:16597136-16597158 GAGCTTTACTTCCAACTGTGTGG + Intronic
926997201 2:18748870-18748892 TAATTTTATTTTTTACTATGTGG + Intergenic
927453338 2:23228261-23228283 GAGTTTTACTTCCAACTATGTGG + Intergenic
927509972 2:23638387-23638409 GTGTTTTTTTTTTCACTCTGAGG + Intronic
927746867 2:25630936-25630958 ATCTTTTATTTTTAACTGTCTGG - Intronic
928348956 2:30529113-30529135 GAAAATTATTTTTAACTGTTTGG - Intronic
928490830 2:31780957-31780979 GTGTTTTATGTTTGATTGTGTGG - Intergenic
928534510 2:32227132-32227154 GAGTGTTATTTTTGACTTTATGG - Intronic
928804268 2:35131894-35131916 AAGTTTTGTTTTAAAATGTGAGG - Intergenic
929068767 2:38008111-38008133 GAGCTTTACTTCCAACTGTGTGG + Intronic
929478123 2:42274201-42274223 GAGTTTTATATTTAACTGAAAGG - Intronic
929748605 2:44685887-44685909 GATTTTTTTTTTTAACTCTGAGG + Intronic
929807047 2:45155392-45155414 GAGGTTAATTCTTCACTGTGAGG + Intergenic
929958256 2:46477246-46477268 TAGTTTTCTTTTTAACAGTCAGG + Intronic
930228023 2:48814095-48814117 TAGTTTTTTTTTTATGTGTGTGG + Intergenic
930488832 2:52042822-52042844 GAGCTTTACTTCCAACTGTGTGG + Intergenic
930564151 2:52998722-52998744 GAGTTTAATTTTAAACTTTCTGG + Intergenic
931030990 2:58174374-58174396 GAGCTTTATTTCCAACTATGTGG - Intronic
931471065 2:62538113-62538135 GAGCATTAATTCTAACTGTGTGG + Intergenic
931533839 2:63249611-63249633 GATTTTTTATGTTAACTGTGGGG + Intronic
931617509 2:64175006-64175028 GAGTTTTATTTTCTACTCTGAGG - Intergenic
931887210 2:66630490-66630512 GAGCTTTATTTCCAACTATGTGG + Intergenic
932113910 2:69027308-69027330 GAGTTTTGTGTTTAATTATGTGG + Intronic
932124199 2:69128597-69128619 GAGTTTTATGTTTGAATATGAGG - Intronic
932356834 2:71074189-71074211 GAGTTTGATAGTTACCTGTGAGG + Intronic
932651045 2:73557130-73557152 GGGTTTTGTTTGTAATTGTGGGG + Intronic
933367491 2:81372192-81372214 CAGTACTATTTTTAACTCTGTGG + Intergenic
934063977 2:88322396-88322418 GAGTTTTCTGTTTAAGTGTGTGG + Intergenic
934910602 2:98250902-98250924 GAATTTTATTTTTATTTTTGTGG - Intronic
935026716 2:99284118-99284140 GAATTTTATTTTTCACTGACTGG - Intronic
935056182 2:99569410-99569432 TCTTTTTATTTTTCACTGTGAGG - Intronic
935277479 2:101487574-101487596 TAGTGTTACTTTTTACTGTGAGG + Intergenic
935350449 2:102147887-102147909 AAGTTTTATTTTTATCATTGAGG - Intronic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
936805603 2:116328229-116328251 TAACTTTATTTTAAACTGTGAGG - Intergenic
936942376 2:117898703-117898725 GAGCTTTACTTCCAACTGTGCGG - Intergenic
937051893 2:118899170-118899192 GAGTTTTACTTCCAACTATGTGG + Intergenic
938476297 2:131617396-131617418 GAGCTTTACTTCCAACTGTGTGG + Intergenic
938535164 2:132233922-132233944 GAGCTTTACTTCCAACTGTGTGG - Intronic
939233182 2:139456954-139456976 TAGTTCTATTTTTAATTTTGAGG + Intergenic
939301543 2:140347801-140347823 GAGTTTTATTTTTCAAGGGGTGG + Intronic
939523309 2:143260676-143260698 GGGTTTTATTTTTAAATTTGTGG + Intronic
940085030 2:149849589-149849611 GATTTGTAATTTTTACTGTGGGG - Intergenic
940176591 2:150884355-150884377 GTGTTTCATGTTTAACTGGGAGG + Intergenic
940213179 2:151276983-151277005 GGCATTTATTTTTAATTGTGTGG + Intronic
940666215 2:156613369-156613391 TGGTTTTCTTTTTAACTGTATGG + Intronic
940876080 2:158898403-158898425 CAGTTTTTTTTTTTACTTTGTGG + Intergenic
941206421 2:162578926-162578948 GAGTTTTTTTTTTTAATCTGTGG + Intronic
941437382 2:165488532-165488554 GAGTTTTACTTCCAACTATGTGG - Intronic
941782053 2:169455498-169455520 GAGTTTTACTTCCAACTATGTGG - Intergenic
942122682 2:172793803-172793825 GAGATTTTTTTTTATGTGTGTGG + Intronic
942747352 2:179250168-179250190 GGATTTTTTTTTTAACTGTTGGG - Intronic
943745887 2:191462575-191462597 ATGTTTTATTTATAACTCTGTGG - Intergenic
943747231 2:191474980-191475002 GATTTTTATTTGTAATTTTGTGG + Intergenic
943946453 2:194071861-194071883 GTGCTTTATTTTCAACTATGTGG + Intergenic
944082260 2:195801404-195801426 GAGTTTAATTTTAAACTGTAAGG - Intronic
944129701 2:196334352-196334374 GATTTCTATTTTTACCTGTGCGG - Intronic
944275398 2:197831756-197831778 GAGTTTTATTTCCAATTATGTGG - Intronic
944424407 2:199564481-199564503 GTGTTTTACTTTTAATTCTGAGG + Intergenic
945058745 2:205890176-205890198 CAATATTTTTTTTAACTGTGAGG - Intergenic
945439029 2:209856141-209856163 TATTTTTATTTTTAACAATGTGG + Intronic
945737698 2:213620896-213620918 GAGTTTTACATTGAAATGTGTGG + Intronic
946912588 2:224479956-224479978 GAGTATTCTTTTTAAATGGGAGG + Intronic
948013041 2:234665157-234665179 GACTTTTAATTTTAACTCTCAGG + Intergenic
948188754 2:236042429-236042451 AAGTTTTACTTTCAAATGTGTGG + Intronic
1169460891 20:5794034-5794056 GATTTTTTTTTTTAAGTGAGGGG - Intronic
1169761184 20:9096762-9096784 GAGATTTCTTTTTCAGTGTGTGG + Intronic
1169996726 20:11565686-11565708 GACTTGTATTTTTTGCTGTGTGG - Intergenic
1169997010 20:11569751-11569773 GAGTTTTATTTTTTACATTTAGG + Intergenic
1170090538 20:12585107-12585129 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1171077481 20:22143274-22143296 GACTTTTTTTTTTAACAGAGAGG + Intergenic
1171442116 20:25173496-25173518 GAGTCTTATCTCTCACTGTGGGG + Intergenic
1172262170 20:33576874-33576896 GAGTTTTATTCTGTACTGGGTGG + Intronic
1172563436 20:35909466-35909488 GAGTTTTGTTTTTATGTTTGGGG + Intronic
1172787303 20:37477458-37477480 AAATTTTAGATTTAACTGTGTGG - Intergenic
1173117358 20:40258173-40258195 GAGTTTTAGTTCTAACACTGAGG - Intergenic
1174197535 20:48784315-48784337 AAGTGTTATTTTTTACTGTTGGG - Intronic
1175666712 20:60867731-60867753 GAGTTTTATTTTTATTTATGTGG - Intergenic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1176917254 21:14641058-14641080 AATTTTTCTTTTTAATTGTGGGG + Intronic
1177045789 21:16168178-16168200 AAACATTATTTTTAACTGTGGGG + Intergenic
1177071892 21:16520697-16520719 GAGTTCTGTGTTTAAGTGTGTGG - Intergenic
1177453176 21:21299432-21299454 TAGTTTTACTTATAACTGAGTGG - Intronic
1177529128 21:22337594-22337616 CAGTTGTATTTTGAAATGTGAGG + Intergenic
1177553747 21:22661493-22661515 GACTTTTATTTTTAGCTTTTGGG + Intergenic
1177670123 21:24214190-24214212 GTGTATTATTTATAACTCTGGGG - Intergenic
1177681001 21:24370718-24370740 GAGTATTATTTGTAACTATTTGG - Intergenic
1177810602 21:25920964-25920986 GAGTTTTACTTCCAACTATGTGG - Intronic
1177863888 21:26489594-26489616 AAGATATATATTTAACTGTGTGG + Intronic
1177916681 21:27097282-27097304 CAGTTTCATTTTTAATTTTGGGG + Intergenic
1179345807 21:40556233-40556255 TACATATATTTTTAACTGTGTGG - Intronic
1179669753 21:42938369-42938391 GACTTTTATTTTTAAATGTACGG + Intergenic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
1180730160 22:17975359-17975381 GAGATTTTTTTTTAAATTTGCGG - Intronic
1180800318 22:18628641-18628663 GAATTATTTTTTTAACAGTGGGG - Intergenic
1180851552 22:19024205-19024227 GAATTATTTTTTTAACAGTGGGG - Intergenic
1181221398 22:21366625-21366647 GAATTATTTTTTTAACAGTGGGG + Intergenic
1183135422 22:35882513-35882535 GAGTATTATTTTTAAATAAGTGG + Intronic
1184814057 22:46857148-46857170 GTTTTTTGTTTTTAACTGTGAGG - Intronic
1184967265 22:47988696-47988718 GAGTTTTATTATCAACTTTGTGG - Intergenic
1185057870 22:48590449-48590471 GAGGTTTCTTTTTAGCAGTGAGG + Intronic
1185282531 22:49980835-49980857 GATTTTTATTTTTATTTTTGGGG - Intergenic
949845425 3:8365486-8365508 GATTTTTTTTTTTAACTTGGGGG + Intergenic
950701214 3:14749696-14749718 GATTTTTTTTTTTTACTGTATGG + Intronic
950921114 3:16695743-16695765 GAGTTTTATTATTACATTTGGGG - Intergenic
951896761 3:27616858-27616880 GAGTTTTTGTTGTTACTGTGAGG + Intergenic
951966752 3:28395355-28395377 TAGTTTTATTTTTAACTTTTTGG - Intronic
952042062 3:29272810-29272832 GATTTTTATTATTATCTGAGAGG - Intergenic
952186653 3:30976853-30976875 GAGATTGATTTATAAATGTGAGG + Intergenic
952618655 3:35307914-35307936 GAATTTTCTTTTTATCTTTGAGG - Intergenic
953652418 3:44819650-44819672 GTGCTTTACTTTTAACTATGTGG + Intronic
954283384 3:49600625-49600647 TATTTTTATTTTTACCTTTGTGG - Intronic
955020444 3:55115840-55115862 GAATTTTATTTTTAAGTTTAAGG - Intergenic
955099642 3:55834346-55834368 GAGCTTTACTTCCAACTGTGTGG - Intronic
955376666 3:58402806-58402828 TATTTTTATTTTTAACTTTTAGG + Intronic
955458750 3:59155599-59155621 GTTTTTGGTTTTTAACTGTGTGG + Intergenic
955794343 3:62620074-62620096 GATTTTTTTTTTTAACTCTTGGG + Intronic
956299728 3:67758921-67758943 GAGTTATATTTCTCACGGTGTGG + Intergenic
956300080 3:67762826-67762848 GTGTTTTATTTCTAATTGTGTGG + Intergenic
957308567 3:78489737-78489759 GAGCTTTACTTCCAACTGTGTGG - Intergenic
957444091 3:80292236-80292258 GGTTTTTCTTTTTAACTATGTGG + Intergenic
957494411 3:80972673-80972695 GACTTTTTTTTTTAAGTGTGTGG - Intergenic
957500436 3:81050383-81050405 TAGTTCTATTTTTAACAGTGAGG + Intergenic
957603893 3:82373700-82373722 GTGTTTTACTTCTAACTGTGTGG + Intergenic
957858577 3:85912720-85912742 GAGTTTCATTCTTAACAATGAGG + Intronic
957999995 3:87738274-87738296 GACTTTTTGTTTTAAATGTGGGG + Intergenic
958527833 3:95286351-95286373 GAGCTTTATTTCCAACTATGTGG + Intergenic
958699912 3:97575661-97575683 AAGTATTATTTTTAAATCTGTGG + Intronic
958776683 3:98492640-98492662 AAGTTCTATTTTTAATTGTTTGG - Intergenic
958938942 3:100288889-100288911 GCTTTTTGTTTTTAACTGTACGG + Intronic
959076125 3:101751318-101751340 GAGCTTTACTTCTAACTGTGTGG + Intronic
959445773 3:106437327-106437349 AAGTTTTATTTTTAAATGACAGG + Intergenic
959557078 3:107732881-107732903 GAGTATTCTTTTTGACTCTGTGG + Intronic
959591094 3:108082318-108082340 AAGATTTATTTTTATCTGTATGG - Intronic
959595781 3:108127099-108127121 GCCATTTATTTTTAACTGTAGGG + Intergenic
960016690 3:112898348-112898370 GAGTTTTATTTTGATCATTGTGG - Intergenic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
960553668 3:119004868-119004890 GAGTTTTACTTCCAACTATGTGG + Intronic
960691190 3:120348619-120348641 AAGCTTTCTCTTTAACTGTGCGG - Intronic
960984129 3:123261557-123261579 GATTTTTATCTAAAACTGTGAGG + Intronic
961050441 3:123740977-123740999 GAGTTTTATTTTGAGGGGTGGGG + Intronic
961161756 3:124732281-124732303 GAGTTGAATTTTGCACTGTGCGG + Intronic
961852865 3:129839224-129839246 GCGTTTTACTTTTACCTGTGGGG - Intronic
962170437 3:133095980-133096002 GCGTTTTAATTTTTGCTGTGTGG + Intronic
962276996 3:134022882-134022904 GACCTTTTGTTTTAACTGTGGGG - Intronic
962484079 3:135824702-135824724 GAGCTTTATTTCCAACTATGTGG - Intergenic
962660223 3:137594717-137594739 GAATTTTTTTTTTATCTTTGTGG + Intergenic
963328214 3:143885297-143885319 GAGTTGTATCTTTAACTTTCTGG - Intergenic
963426009 3:145124694-145124716 GACATTAATTTTTTACTGTGTGG - Intergenic
963961294 3:151312142-151312164 CAGTTTTATTTGTAATTTTGGGG + Intronic
964060119 3:152511883-152511905 GAGATTTATTTTTAAAGGAGAGG + Intergenic
964134923 3:153334333-153334355 GAGTTCTGATTTTATCTGTGAGG + Intergenic
964285636 3:155114776-155114798 TCGTTTTATTTTGAACTGTGTGG - Intronic
964613410 3:158637112-158637134 GAGCTTTACTTCCAACTGTGTGG - Intergenic
965243703 3:166236848-166236870 GGGTTTTATGTATTACTGTGAGG + Intergenic
965601599 3:170460000-170460022 GTGTTTTATTTTCAAATGTGTGG - Exonic
965875697 3:173316559-173316581 GAGATCTATTTTTCACTGTGAGG - Intergenic
965930914 3:174042407-174042429 GAGATTTATTTTTTACCATGTGG + Intronic
966111839 3:176412342-176412364 GTGTTATATTTTCAGCTGTGTGG + Intergenic
966476526 3:180354624-180354646 GGGATGTATTTTTAGCTGTGGGG - Intergenic
967467684 3:189826436-189826458 TTGTTTTATTTTTAACTTTCTGG + Intronic
967796943 3:193608608-193608630 GAGCTTTATTTCCAACTATGTGG + Intronic
967797970 3:193619185-193619207 GAGTTGTGTTGTTAAGTGTGTGG + Intronic
968293804 3:197557940-197557962 GTGATTTATTTTTAACCCTGTGG - Intronic
969168185 4:5335884-5335906 GAGCTTTATTTCCAACTATGTGG + Intronic
970375136 4:15449634-15449656 TAGTTTTATTTTTAGCTCTTTGG - Intergenic
970394495 4:15652871-15652893 TAGTTTTATTGTAAACTGTTTGG + Intronic
970745431 4:19288908-19288930 GAGCTTTATTATTAATTTTGAGG - Intergenic
971023197 4:22559748-22559770 GATTTCTATTTTTAACTTTGGGG - Intergenic
971673503 4:29594929-29594951 TAGTTTTCTTTCTAACAGTGAGG + Intergenic
971790986 4:31169474-31169496 GTATTCTACTTTTAACTGTGTGG + Intergenic
972077394 4:35104584-35104606 GAGTTTTAACTCAAACTGTGGGG + Intergenic
973053678 4:45628172-45628194 CTTTTTTATTTTTAACTGTATGG + Intergenic
973161419 4:47021724-47021746 GAGTTTTGATTTTGACTTTGTGG + Intronic
973183587 4:47296845-47296867 GAGCTTTACTTCCAACTGTGTGG - Intronic
973887869 4:55341257-55341279 GATTTTTTGTTTTAAATGTGGGG - Intergenic
973951258 4:56016679-56016701 GAGTTTTTTTTTTAAGAGTCAGG + Intronic
973957887 4:56081257-56081279 TAGTTTTATTTTTAACCATCCGG + Intergenic
974184348 4:58427308-58427330 GATAATTATTTTTAACTCTGGGG + Intergenic
974193586 4:58540148-58540170 GAGTTTTATTTTTATTAATGTGG + Intergenic
974231510 4:59121419-59121441 GACATTTATTTTTAATTTTGGGG + Intergenic
975077266 4:70226495-70226517 CAGGTTTATTTTTAAATTTGTGG + Intronic
975163539 4:71150969-71150991 GATTTTCATTTCTAATTGTGAGG + Intergenic
975227785 4:71894117-71894139 GAGTTTTACTTCTAATTATGAGG - Intergenic
975274241 4:72477277-72477299 GAGCTTTACTTCCAACTGTGTGG - Intronic
975346931 4:73302296-73302318 GAGTTTTATCCCTTACTGTGAGG - Intergenic
975482767 4:74900096-74900118 CAGTTTTAGTTTTAATTTTGAGG + Intergenic
975631092 4:76403039-76403061 ATGTTTTATTTTTAACCATGTGG - Intronic
976035421 4:80813444-80813466 GAGTTGTATATTAAACTATGGGG + Intronic
976117967 4:81748486-81748508 TAATTTTATTTTTAATTTTGTGG + Intronic
976226712 4:82799804-82799826 GAGTTCTAGTTTTAACTGGCTGG + Intergenic
976487509 4:85625477-85625499 GAGTTTTACTTCCAACTATGTGG + Intronic
976868846 4:89765680-89765702 AAGATTTATTTTTATCTGGGTGG + Intronic
976964252 4:91015532-91015554 AAGTTATATTTTTATTTGTGTGG + Intronic
977519175 4:98059176-98059198 GATGTTTATTTTTAATTCTGTGG - Intronic
977692189 4:99925850-99925872 GATTTGAATTCTTAACTGTGAGG - Intronic
977987595 4:103402335-103402357 GAATTTTATGTCTTACTGTGTGG + Intergenic
978655176 4:111057437-111057459 CAGTTTTATTTTTAATTTTTGGG - Intergenic
979112907 4:116781416-116781438 GAGTTTTATGATTTACTGTATGG + Intergenic
979198741 4:117951177-117951199 GAGTTTTACTTCCAACTATGTGG - Intergenic
979363732 4:119795365-119795387 AAGTTTTATCTTTGAATGTGAGG - Intergenic
979535531 4:121815968-121815990 GAGTTTTATTTTTATTTTTTGGG + Intronic
979573480 4:122257655-122257677 GTAATTTATTTGTAACTGTGAGG - Intronic
979800975 4:124908540-124908562 GAGTTCTATTTTTAATTTGGGGG + Intergenic
979935977 4:126696478-126696500 TATTTTTATTTTTAAATGTGTGG - Intergenic
980296833 4:130930130-130930152 GAGTACTATTTTTAATTTTGGGG + Intergenic
980306901 4:131073611-131073633 GAGCTTTACTTCCAACTGTGTGG - Intergenic
980631633 4:135443959-135443981 TAGTTTTAATTTTAACTATTGGG - Intergenic
980670078 4:135994131-135994153 TAATTTTGTTTTTAAATGTGAGG - Intergenic
980687129 4:136242870-136242892 TATTTTTATTTTTAATTCTGGGG - Intergenic
981293485 4:143102860-143102882 GAGTTTTACTTCCAACTATGTGG - Intergenic
981839229 4:149091999-149092021 GAGCTTTACTTCCAACTGTGAGG + Intergenic
981842617 4:149130075-149130097 GAGCTTTACTTCCAACTGTGAGG - Intergenic
982311611 4:153991337-153991359 TAGTTCTATTTTTAATTTTGGGG + Intergenic
982647168 4:158038084-158038106 GTGTTTTATATTGAGCTGTGTGG - Intergenic
982890108 4:160836464-160836486 TAGTTTTAATTTTAAATGTATGG + Intergenic
982968093 4:161941109-161941131 GAGTTTAATTTTTAAAACTGGGG + Intronic
983144321 4:164194214-164194236 TAATTTTAATTTTAATTGTGTGG + Intronic
983286214 4:165742772-165742794 CAGTTTTATTTTTGACCCTGTGG - Intergenic
983766454 4:171490121-171490143 TAATTGTGTTTTTAACTGTGAGG + Intergenic
983791468 4:171802652-171802674 GTGTTTTATTTTCAATTATGTGG + Intergenic
983794525 4:171844519-171844541 AAGTTTTATTTTCAGATGTGAGG + Intronic
985087397 4:186326909-186326931 GATTTTTGGTTTTTACTGTGGGG + Intergenic
985234681 4:187860169-187860191 GAGCTTTACTTTCAACTATGTGG + Intergenic
985755941 5:1716996-1717018 GAGTTTTAGTTTAAATTATGAGG + Intergenic
986055256 5:4130155-4130177 AACTATTATTTTTAACTCTGGGG + Intergenic
986207177 5:5635935-5635957 GAGTTTTATTTTTGAGAATGGGG + Intergenic
986619676 5:9659389-9659411 GAGATCTATTATTAAATGTGGGG - Intronic
986694137 5:10337317-10337339 GAGTTTGATCTGTAACTGTCTGG - Intergenic
986727772 5:10612254-10612276 GAGATTTATTTCTCACTGTTTGG + Intronic
987110079 5:14677649-14677671 GAGTTGTATTTTTAATTTTGGGG + Intronic
987491572 5:18586470-18586492 TTGTTTTGTTTTTAACTCTGAGG - Intergenic
987583748 5:19827476-19827498 TTGTTTTATTTTTTATTGTGTGG - Intronic
987645595 5:20668167-20668189 GATTTTCATTTTTATCTGTTTGG + Intergenic
987775414 5:22359666-22359688 GTGCTTTACTTTCAACTGTGTGG - Intronic
988049425 5:26006777-26006799 TATTTTTATTTTTTACTGTAGGG + Intergenic
988110085 5:26808148-26808170 GAGTTTTACTTTTGCCTATGGGG - Intergenic
988591130 5:32550620-32550642 TAGTTCTATTTTTAACTTTGTGG + Intronic
988779957 5:34511527-34511549 TAGTTTTTATTATAACTGTGTGG + Intergenic
988799942 5:34687163-34687185 TATTTTTATTTTTAATTTTGGGG + Intronic
989096119 5:37782785-37782807 GACTTTTTGTTTTAAATGTGGGG + Intergenic
989397464 5:40973406-40973428 GAAATTTATTTTTAATAGTGAGG + Intronic
990192115 5:53270725-53270747 GAGCTTTATTTCCAACTATGTGG - Intergenic
990209404 5:53466255-53466277 GAGTTTTTTTTTTAAATCTAAGG - Intergenic
990306897 5:54502816-54502838 TAGTTATATTTTGCACTGTGAGG - Intergenic
990330141 5:54717625-54717647 TAGTTTTATTTTTAACTTTTTGG - Intergenic
990536764 5:56730898-56730920 GTGTTTTGTTTTACACTGTGAGG + Intergenic
990882604 5:60556413-60556435 TAGTTTTCCTTTTAACAGTGAGG - Intergenic
991167849 5:63584507-63584529 GAGTTTTACTTCCAACTATGTGG - Intergenic
991265423 5:64712444-64712466 GAGTTTTACTTCCAACTATGTGG + Intronic
992148510 5:73877827-73877849 GAGCTTTACTTCCAACTGTGTGG + Intronic
992691513 5:79245201-79245223 GAATTTTATTTGTAACTTTCAGG + Intronic
993221642 5:85105914-85105936 GTGTTTCATTTTTCACTTTGAGG + Intergenic
993230057 5:85224162-85224184 CAGTGTAATTTTTAAATGTGAGG - Intergenic
993231231 5:85239671-85239693 GAGATTTATTATTAATTTTGTGG - Intergenic
993265747 5:85724049-85724071 GTGTTTTATTTTGAATTATGTGG - Intergenic
993403853 5:87487014-87487036 GTGTTTTACTTTTAATTATGTGG + Intergenic
993774096 5:91969742-91969764 GATTTTCATTTTAAAATGTGTGG + Intergenic
993917807 5:93763784-93763806 GAGCTTTACTTCCAACTGTGTGG - Intronic
993932588 5:93958920-93958942 GAGTTTTATCTTTATGAGTGAGG - Exonic
994079098 5:95686431-95686453 TAGTTTTTTTTTTAACTTGGAGG - Intronic
994137694 5:96306855-96306877 GTGTTTTACTTTCAACTATGTGG + Intergenic
994249230 5:97517321-97517343 GAGCTTTACTTCCAACTGTGTGG + Intergenic
994266323 5:97721195-97721217 GTGTTTTACTTCCAACTGTGTGG + Intergenic
994574985 5:101566908-101566930 GAGTTTTACTTCTAATTGTGTGG + Intergenic
994636819 5:102354032-102354054 GTGTTTTACTTCTAACTATGTGG - Intergenic
994644079 5:102447685-102447707 GGGTTTTTTGTATAACTGTGAGG + Intronic
994765128 5:103905760-103905782 GAGTTTTATTTTTAGCTTTTGGG - Intergenic
995173293 5:109142833-109142855 GTGTTTTATATTAAAATGTGAGG + Intronic
995651566 5:114375158-114375180 CTGTTTAATTTTTTACTGTGTGG + Intronic
995695848 5:114877133-114877155 TAGTTTTGTTTCTAACAGTGAGG - Intergenic
995713462 5:115058305-115058327 GAGCTTTACTTCTAACTATGCGG + Intergenic
995849499 5:116530655-116530677 CAGTTTTATTTAAAACTGTTTGG + Intronic
996217690 5:120889068-120889090 GTGTTTTATGTTTAAGTCTGTGG + Intergenic
996280427 5:121723777-121723799 GAGTTTTACTTCTAATTATGTGG + Intergenic
996636857 5:125701421-125701443 GACTTTTATTTTTTACTGTATGG - Intergenic
998528360 5:142863014-142863036 GCCTTTTATTTTTAATGGTGAGG - Intronic
998605900 5:143634328-143634350 GTCTTTTTTTTTTAACAGTGAGG - Intergenic
999096764 5:148985831-148985853 CACTTTTATTTTTCAATGTGTGG + Intronic
999397360 5:151238550-151238572 AAGTTTTATTTTTAGCTGCTGGG - Intronic
999837474 5:155390041-155390063 GATTTTTATTTTCACATGTGAGG - Intergenic
1000116480 5:158158719-158158741 TAATTTTAGTTTTCACTGTGTGG + Intergenic
1000169858 5:158691396-158691418 TTGTTTTATTTTTTACTGTAGGG - Intergenic
1000598102 5:163238870-163238892 GTGCTTTATTTTCAACTATGTGG - Intergenic
1000790819 5:165604914-165604936 GAGTTATAGTTTTAAATGTTCGG + Intergenic
1001190082 5:169621623-169621645 GAGTTTTACTTCCAACTATGTGG - Intergenic
1001848633 5:174943307-174943329 AAGCATTATTTTTAAATGTGGGG - Intergenic
1002652913 5:180716137-180716159 GTCTTTTATTTTGAACTGTAAGG - Intergenic
1002999196 6:2315094-2315116 GACTTTTTCTTTTAAATGTGGGG + Intergenic
1003807963 6:9747798-9747820 AAGTATCATTTTTAACTCTGAGG + Intronic
1004123438 6:12849260-12849282 GCGCTTTATTGTTAATTGTGAGG - Intronic
1005168342 6:22951901-22951923 GCATTTTATTTTTAATTTTGTGG - Intergenic
1005342856 6:24859435-24859457 GAATTTTTATTTTAACTTTGAGG - Intronic
1005430371 6:25750469-25750491 CAGTTTTATCTTTAACTGTTGGG - Intergenic
1006322230 6:33326522-33326544 TTGTTTTATTTTAAAATGTGGGG + Intronic
1007129525 6:39457106-39457128 GAGTTTTACTTCCAACTATGTGG - Intronic
1007434682 6:41800979-41801001 TAATTTTGTTTCTAACTGTGGGG + Intronic
1007858978 6:44887354-44887376 GAGCTTTATTTCCAACCGTGTGG - Intronic
1007920706 6:45607103-45607125 GAGTTTTATGTGTACCTCTGAGG + Intronic
1008374355 6:50774386-50774408 TAGTATTATTTTTAATTGAGGGG + Intergenic
1008619285 6:53256062-53256084 GATTTTTATTTTTCCCTTTGTGG - Intergenic
1008625930 6:53316504-53316526 GAGTTTGTTTTTAAACTGGGGGG + Intronic
1008737335 6:54561594-54561616 GTGATTGATTTTTGACTGTGTGG - Intergenic
1008821086 6:55631007-55631029 GAGTTTGATTATTAAATGTCTGG + Intergenic
1009668146 6:66709530-66709552 GAGTTTTACTTTTTTCTGGGGGG + Intergenic
1009711325 6:67325320-67325342 GAGTTTTTTTTTTGAGTTTGGGG + Intergenic
1009775989 6:68206518-68206540 TAGTTTTCTTTCTAACTGTCAGG - Intergenic
1009961354 6:70526120-70526142 GAGTTTCACTTTCAACTGTAGGG - Exonic
1009963555 6:70553727-70553749 AAATTTTATTTTTAATTGTTTGG - Intronic
1010129299 6:72472157-72472179 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1010482957 6:76376893-76376915 GAGTTTTACTTCCAACTATGTGG + Intergenic
1010485522 6:76407883-76407905 TAGTTCTATTTTTAATTTTGGGG + Intergenic
1010757188 6:79679619-79679641 TAGTTCTATTTTTAATTTTGGGG + Intronic
1010807341 6:80253459-80253481 GAGTTTTATTTATAATTCTTGGG + Intronic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1011276409 6:85635814-85635836 GAGTTTTATTTTTCTCTTTAAGG + Intronic
1011397391 6:86923893-86923915 GAGCTTTACTTTGAACTATGTGG - Intergenic
1011838311 6:91462231-91462253 GTTTTTTTTTCTTAACTGTGTGG + Intergenic
1012032801 6:94094127-94094149 GCGTTTTATTTTTTTCTGTATGG + Intergenic
1012201068 6:96406582-96406604 GATTTTTTTTTTTTACTTTGGGG + Intergenic
1012287789 6:97414401-97414423 GAGTTTTTTTTTTAAATATTAGG - Intergenic
1012632460 6:101488884-101488906 GAGTTTTCTTTATAATTCTGAGG + Intronic
1012685462 6:102242761-102242783 GATTTTTCTTTTTAAATATGAGG + Intergenic
1012731741 6:102892017-102892039 GATTTTTTTTTCTAACTGTTTGG + Intergenic
1013426607 6:110018190-110018212 TTATTTTATTTTTATCTGTGAGG - Intergenic
1013532731 6:111034965-111034987 TAGTTTTATTTTTAAATTTGGGG - Intergenic
1013782569 6:113745393-113745415 TTATTTTATTTTTAATTGTGTGG + Intergenic
1013820086 6:114144480-114144502 GAGTTTAATTTTAGGCTGTGTGG - Intronic
1013889660 6:115011051-115011073 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1014060457 6:117065360-117065382 GTGCTTTATTTTGAAATGTGTGG - Intergenic
1014257171 6:119172839-119172861 GAGTTTTATTTTTTGGTTTGTGG - Intergenic
1014805884 6:125828750-125828772 GTGTTTTAGTTTTACTTGTGCGG + Intronic
1015314074 6:131797197-131797219 TAACTTTATCTTTAACTGTGAGG - Intergenic
1015428833 6:133105797-133105819 GTTTTTTATTTTTAATTGTTTGG + Intergenic
1016015337 6:139178504-139178526 TTTTTTTTTTTTTAACTGTGTGG + Exonic
1016296633 6:142579726-142579748 GAGCTTTACTTCTAACTATGTGG - Intergenic
1016580104 6:145619703-145619725 AAATTTTTTTTTTAATTGTGAGG - Intronic
1016721235 6:147301244-147301266 TAGTTCTATTTTTAACTTTTTGG - Intronic
1017309861 6:152962504-152962526 TAGTTTTATTTTTAATTTTGGGG - Intergenic
1018043663 6:159947037-159947059 GGGTGCTATTTTTAACTCTGTGG + Intergenic
1018697127 6:166398981-166399003 GAATTTAAATTTTAATTGTGTGG - Intergenic
1020210005 7:6152022-6152044 GATTTTTTTTTTAAATTGTGGGG - Intronic
1020830411 7:13088158-13088180 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1021280757 7:18714984-18715006 GATATTTATTTTTAAGTTTGAGG + Intronic
1021391947 7:20103536-20103558 GATTTTTATTTTTTATTTTGTGG - Intergenic
1021495317 7:21268087-21268109 GAATTTTTTTTTTTAATGTGAGG + Intergenic
1021749078 7:23777228-23777250 GTGTTTTACTTCCAACTGTGTGG + Intronic
1022079664 7:27007647-27007669 TAGTTTTACTTTTAACAGTCAGG + Intergenic
1022179090 7:27900597-27900619 GATTATTATTTTTTAATGTGGGG + Intronic
1022389877 7:29934487-29934509 GAGTTCTATTTTCAAGTGTCTGG - Intronic
1022409370 7:30126082-30126104 GATTTTTTTTTTTCACTCTGAGG + Intronic
1022613584 7:31904471-31904493 GATTTTTTTTTTTAAGTGAGTGG - Intronic
1022646938 7:32240512-32240534 AAGTATTATTTTAAACAGTGTGG + Intronic
1023288667 7:38646083-38646105 GAGTTATATTTTTATCTATATGG + Intergenic
1023922862 7:44643145-44643167 GAGTTTTGTTTTTAACAGATGGG + Intronic
1023953422 7:44866466-44866488 GTGATTGTTTTTTAACTGTGTGG - Intergenic
1024174244 7:46822227-46822249 GAGCTTTATTTCCAACTATGTGG - Intergenic
1024876687 7:54032989-54033011 GAGTGTTGTTCTTAATTGTGTGG + Intergenic
1025935827 7:66036066-66036088 TAATTTTATTTTTAACTTTATGG - Intergenic
1026464491 7:70642438-70642460 TAGTTTTATTTTTCACTTTTAGG + Intronic
1026533239 7:71218494-71218516 GAGTTTTAAATATAACTGTAGGG + Intronic
1027263613 7:76481812-76481834 TAGTTTTATTTTTAAAAGTATGG + Intronic
1027299441 7:76815219-76815241 GACTTTTTTTTGTAACTCTGTGG + Intergenic
1027864458 7:83629018-83629040 GAGTTTTCTTTCTAACAGTCAGG + Intronic
1027885048 7:83893630-83893652 GAGTTTTAATTCCAACTATGTGG + Intergenic
1027927709 7:84488365-84488387 GAATTTTCTTCTTATCTGTGGGG - Intronic
1027965804 7:85005675-85005697 GAGATTTTTCTTTTACTGTGAGG + Intronic
1028062784 7:86342807-86342829 GAGCTTTATTTCCAACTATGTGG - Intergenic
1028387764 7:90277205-90277227 GATTTTGACTTTTAACTGTGAGG - Exonic
1028681839 7:93544599-93544621 GATTTTAGTTTTTCACTGTGTGG + Intronic
1029958656 7:104667036-104667058 AAGTTTTATTTTTAGCTTTTTGG + Intronic
1030096553 7:105905814-105905836 CAGTTGTATTCATAACTGTGGGG + Intronic
1030188449 7:106787151-106787173 ACCTTTAATTTTTAACTGTGTGG - Intergenic
1030447787 7:109669148-109669170 GAGTTATTTTTTTAAGTGTGAGG + Intergenic
1031461154 7:122050829-122050851 GTGTTTTATTTTTGACAGTCGGG - Intronic
1031722113 7:125189054-125189076 GAGTTTAATTATTAATTGTCTGG - Intergenic
1031891218 7:127295220-127295242 GAGTTTTCTTTTTAAGTGACTGG - Intergenic
1033502273 7:141963993-141964015 TAATTTTATTTTTAACTCTTTGG + Intronic
1034464266 7:151217013-151217035 GTGATTATTTTTTAACTGTGTGG - Intronic
1036113173 8:5928878-5928900 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1036153528 8:6320649-6320671 GAGTTTAATATTTAAATGAGTGG - Intergenic
1036386813 8:8288939-8288961 AAGTTATATTCTTAAATGTGAGG - Intergenic
1036559935 8:9893090-9893112 CTTTTTTATTTTTAAATGTGTGG + Intergenic
1036576098 8:10029058-10029080 GAGTTTTACTTTCAAATGTCTGG - Intergenic
1036697229 8:10984000-10984022 TAGTTTTATTTTTTATTTTGGGG - Intronic
1036946311 8:13098309-13098331 AAGTGTCATTTTTTACTGTGGGG + Intronic
1037067668 8:14602290-14602312 GAGTTGTATTTATGACAGTGAGG + Intronic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038164371 8:25070884-25070906 AATTTTTATTTTTAATTTTGTGG - Intergenic
1039170628 8:34740774-34740796 GTGCTTTACTTTCAACTGTGTGG - Intergenic
1040831947 8:51686823-51686845 GCTTTTTATTTTTTATTGTGAGG - Intronic
1041227066 8:55711330-55711352 GACTTTTTGTTTTAAATGTGGGG - Intronic
1041474854 8:58252988-58253010 TACTTTTATTTTTAACTTTCTGG + Intergenic
1041701653 8:60796399-60796421 GAGTTTTATTTTTATCCGTAAGG + Intronic
1041976043 8:63800818-63800840 GAGCTTTATTTCCAACTATGTGG + Intergenic
1042443691 8:68858761-68858783 GAGTTGTATTTTTAAATTTATGG + Intergenic
1042697134 8:71567277-71567299 AAGTTTTTCTTTTAATTGTGTGG - Intronic
1043304117 8:78772898-78772920 GTGATTCTTTTTTAACTGTGTGG - Intronic
1043347364 8:79314903-79314925 TAGGTTTATTTTTAATTCTGAGG - Intergenic
1043496801 8:80810223-80810245 GAATTTGATTTTTATCTGTTAGG - Intronic
1044135640 8:88582463-88582485 GTGTTTTACTTTTAACTGTGTGG + Intergenic
1044190182 8:89306770-89306792 CAGTTTTATTTTTAATTGGCAGG - Intergenic
1044244334 8:89924355-89924377 TAGTTTTTTTTTTAAGTGTTAGG + Intronic
1044403252 8:91796147-91796169 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1044412005 8:91893935-91893957 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1045173067 8:99692279-99692301 GAGTTTTACTTCCAACTATGTGG - Intronic
1045591378 8:103602306-103602328 GACTTTTATTTTTAGGTTTGGGG + Intronic
1045649601 8:104329694-104329716 GAATTTGATTTTTAAAAGTGAGG + Intergenic
1045792857 8:106005884-106005906 GAGTTTTATTATTAAGTGCCTGG - Intergenic
1045936098 8:107681208-107681230 GTGTTATATTTTTAACTTTTTGG + Intergenic
1045979584 8:108168983-108169005 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1046097312 8:109577130-109577152 GAGTTTTCTTTATATCTTTGTGG + Intronic
1046564222 8:115878120-115878142 TATTTTTATTTTTAATTTTGTGG + Intergenic
1046709107 8:117489396-117489418 GTGTTTTACTTTTAATTATGTGG - Intergenic
1046982441 8:120350973-120350995 GAGTTTTACTTCCAACTATGTGG - Intronic
1047856918 8:128920489-128920511 TAATTTTATTTTTAATTTTGAGG - Intergenic
1048144682 8:131829906-131829928 GAGTTTTCTTTTTAAATTTAGGG - Intergenic
1048370553 8:133772896-133772918 GAGTTTTATAGTTCACTTTGAGG + Intergenic
1048554999 8:135467122-135467144 AATTTTTATTTTTAATTGTGGGG - Intronic
1048626699 8:136193599-136193621 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1048659940 8:136587805-136587827 CAGTTATATTTTTAACTGGATGG + Intergenic
1048879713 8:138862279-138862301 GAGTTTTATTGTTAGTTGAGTGG - Intronic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1049919398 9:349135-349157 CTGTTTTATTTTGTACTGTGGGG - Intronic
1050795638 9:9537721-9537743 CAGAATTATTTTTAACAGTGAGG - Intronic
1050915122 9:11121998-11122020 ATGATTTATTTTTAATTGTGAGG - Intergenic
1051462819 9:17342447-17342469 GAGTTTCATTTTTAACAATATGG + Intronic
1051581201 9:18676816-18676838 TAATTTTATTTTGAACTGTAAGG + Intronic
1051650241 9:19315976-19315998 TATGATTATTTTTAACTGTGAGG + Intronic
1051724126 9:20071228-20071250 TAGTTTTTTTTATAACAGTGTGG + Intergenic
1051962344 9:22782502-22782524 GAGTTGCATTTTTAATAGTGTGG + Intergenic
1052036178 9:23683644-23683666 TTTTTTTTTTTTTAACTGTGGGG - Intergenic
1052074853 9:24128734-24128756 GGGTTTTTTTTTTTCCTGTGGGG + Intergenic
1052401169 9:28001949-28001971 AATTTTAATTTTCAACTGTGTGG - Intronic
1052527107 9:29631933-29631955 GAGTTTTACCTTTAAGGGTGTGG - Intergenic
1052562980 9:30109467-30109489 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1052762086 9:32602961-32602983 CAGTTTTACTTTCAACTGTACGG - Intergenic
1053330404 9:37200956-37200978 GAATTTTAATTTTGAGTGTGAGG + Intronic
1053531076 9:38881755-38881777 GTGTTTTGTGTTCAACTGTGTGG - Intergenic
1053603874 9:39637289-39637311 GATTTTTATTTTAAAAAGTGTGG + Intergenic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1053861691 9:42393336-42393358 GATTTTTATTTTAAAAAGTGTGG + Intergenic
1054203299 9:62106187-62106209 GTGTTTTGTGTTCAACTGTGTGG - Intergenic
1054249667 9:62705125-62705147 GATTTTTATTTTAAAAAGTGTGG - Intergenic
1054563777 9:66739657-66739679 GATTTTTATTTTAAAAAGTGTGG - Intergenic
1054635063 9:67482177-67482199 GTGTTTTGTGTTCAACTGTGTGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1054980463 9:71200278-71200300 GAGCTTTATTTCCAACTATGTGG + Intronic
1055004696 9:71492349-71492371 GAGCATTATCTTTAACTGAGTGG - Intergenic
1055014255 9:71598552-71598574 GTGTTTTACTTCCAACTGTGTGG - Intergenic
1055415827 9:76081892-76081914 GAGATTTGTTTCTAACTGTGAGG - Intronic
1055520099 9:77072006-77072028 GAGATCTATTATTAACTGTGAGG + Intergenic
1056321181 9:85436143-85436165 GTGTTTTACTTCCAACTGTGTGG - Intergenic
1057639121 9:96799730-96799752 GAGCTTTACTTCTAACTATGTGG - Intergenic
1057911690 9:99024538-99024560 TAGTTTTCTGATTAACTGTGAGG - Intronic
1058169658 9:101665187-101665209 GAGTTTCATTTTTAGATTTGGGG + Intronic
1058391458 9:104500130-104500152 TAATTTTATTATTTACTGTGTGG - Intergenic
1058517192 9:105788479-105788501 GTGCTTTACTTCTAACTGTGTGG + Intergenic
1058988590 9:110233177-110233199 GTGCTTTATTTCCAACTGTGTGG + Intergenic
1059690389 9:116679613-116679635 GAGTTTTACTTCCAACTATGTGG - Intronic
1060371154 9:123073053-123073075 AAGCTATATTTTTAACAGTGAGG + Intronic
1060512883 9:124246969-124246991 CAGTTTATTTTTTAACTGTAGGG + Intergenic
1185808175 X:3079647-3079669 TAGTTCTATTTTTAAAGGTGAGG + Intronic
1185831576 X:3308054-3308076 CAGTTTTTTTTTTAACTCTGTGG - Intergenic
1186066110 X:5766537-5766559 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1186738518 X:12492694-12492716 GATTTTTACTTCTATCTGTGGGG + Intronic
1186741230 X:12520511-12520533 TATTTTTTTTTTTAACTGTGGGG - Intronic
1188778453 X:34251290-34251312 GAGTTTTACTTCCAACTATGTGG + Intergenic
1188843130 X:35040018-35040040 TTGTTTTATGTTCAACTGTGTGG - Intergenic
1188921909 X:35987391-35987413 GAGGCTTATTTTACACTGTGAGG + Intronic
1188944775 X:36286342-36286364 TATTTTTATTTTTAAATATGTGG + Intronic
1189572095 X:42308739-42308761 GTGTTTTACTTTTAATTATGTGG - Intergenic
1189625365 X:42890941-42890963 GAGTTTTACTTCCAACTATGTGG - Intergenic
1189797707 X:44661489-44661511 AAGTTTTGTTTTTCACGGTGAGG + Intergenic
1189942572 X:46140651-46140673 TTGTTTTATCTTTTACTGTGAGG + Intergenic
1190392765 X:49948447-49948469 GTGTTTTTTTTTTAATTCTGTGG + Intronic
1190399894 X:50022882-50022904 GAGCTTTACTTCCAACTGTGTGG + Intronic
1190410248 X:50130028-50130050 GAGTTTATTCTTTAAGTGTGAGG + Intergenic
1190420475 X:50225428-50225450 GATTTTTATTTTAAATTCTGTGG + Intronic
1190599337 X:52073574-52073596 GTGTTTTATTTTTGTGTGTGTGG + Intergenic
1190609487 X:52180499-52180521 GTGTTTTATTTTTGTGTGTGTGG - Intergenic
1190707048 X:53037989-53038011 TAGCTTTATTTTTCACAGTGTGG + Intergenic
1191036121 X:56028094-56028116 GAGTTTTAACTCAAACTGTGGGG - Intergenic
1191049584 X:56177304-56177326 TAGTTTTATTTCTAACAGTCAGG + Intergenic
1191079526 X:56494665-56494687 GAGTTTTCCTTCTAACTGTCAGG + Intergenic
1191193027 X:57686985-57687007 GTGCTTTACTTCTAACTGTGTGG - Intergenic
1191567490 X:62558173-62558195 GAGCTTTATTTCCAACTATGCGG - Intergenic
1191760142 X:64637951-64637973 GATTATTATTTTTTGCTGTGCGG + Intergenic
1191918049 X:66223258-66223280 GACTTTTTGTTTTAAATGTGGGG + Intronic
1191929046 X:66348684-66348706 GAGCTTTACTTCCAACTGTGTGG - Intergenic
1191959962 X:66690388-66690410 GAGTTTTATTTCCACCTATGTGG + Intergenic
1191966479 X:66764501-66764523 GTGTTTTATTTTCAATTATGTGG + Intergenic
1192000735 X:67148482-67148504 GTGTTTCACTTTTAATTGTGTGG + Intergenic
1192003968 X:67189848-67189870 GAGCTTTACTTTCAACTATGTGG + Intergenic
1192020674 X:67387196-67387218 TAGTTTTCTTTTTAACAGTCAGG - Intergenic
1192570155 X:72196682-72196704 GTGTTTTTTTTTTAACTGGTGGG + Intronic
1192922506 X:75722007-75722029 GTGTTTTACTTTTAATTATGTGG + Intergenic
1192992223 X:76472145-76472167 TAGTTTTATTTCTAACAGTCAGG - Intergenic
1192994247 X:76495367-76495389 GTGTTTTATTTTCAATTATGTGG - Intergenic
1193068848 X:77285592-77285614 GTGTTTTACTTTCAACTATGTGG - Intergenic
1193502129 X:82290765-82290787 GATTTTTTTTATTAACTGAGAGG + Intergenic
1193510282 X:82390818-82390840 GTGTTTTACTTTTAATTATGTGG - Intergenic
1193531923 X:82665150-82665172 GAATTTTTTTTTTACCTCTGTGG + Intergenic
1193634914 X:83937643-83937665 GAGTTTTTTGTGTATCTGTGGGG + Intergenic
1193672900 X:84411569-84411591 TTGTTTTATGGTTAACTGTGTGG + Intronic
1193714226 X:84918643-84918665 TAGTTTTTTTTTTTTCTGTGCGG - Intergenic
1193782169 X:85717058-85717080 GTGTTTTATTTTTAATTATGTGG + Intergenic
1193785443 X:85755125-85755147 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1194007222 X:88509735-88509757 TAGTTTTACTCTTATCTGTGGGG - Intergenic
1194217228 X:91145892-91145914 GATTTTTTTTTTTTTCTGTGTGG + Intergenic
1194233239 X:91349569-91349591 GAATTTTGTTTTTTACTGTATGG - Intergenic
1194241981 X:91461147-91461169 TAGTTCTATTTTTAATTTTGGGG - Intergenic
1194532340 X:95066794-95066816 AAGATTTTTTTTTAATTGTGTGG - Intergenic
1194761507 X:97801319-97801341 GAGCTTTACTTCCAACTGTGTGG + Intergenic
1195898591 X:109773640-109773662 GAGTTTTGTGTTTTACTGTAAGG + Intergenic
1195924595 X:110012921-110012943 GAGTTTTATTCTGAGCTGGGTGG + Intronic
1195949921 X:110259198-110259220 GAGTTTTATTTTGTTCTGTGTGG - Intronic
1196148728 X:112348442-112348464 GATTTTTATTTTTTATTTTGTGG - Intergenic
1196588385 X:117457410-117457432 AAATTTTATTTTTAACTTTCTGG + Intergenic
1196963306 X:121027062-121027084 GAGTTAACTTTGTAACTGTGAGG + Intergenic
1197105146 X:122704642-122704664 GAGTTTTATTATATACTTTGAGG - Intergenic
1197133828 X:123037754-123037776 GATTTTTTTTTTTAAGTGGGAGG - Intergenic
1197496043 X:127182221-127182243 GATTTTTTTTTTTAAGTTTGGGG - Intergenic
1197858426 X:130944267-130944289 AAGCTTTTTTTTTTACTGTGTGG + Intergenic
1198745310 X:139883915-139883937 GAGTTTTATTGTAGACTTTGTGG - Intronic
1198809212 X:140518543-140518565 TATTTTTATTTTTAATTTTGGGG - Intergenic
1199025578 X:142933215-142933237 GAGTTTATTTTCTAACTCTGAGG + Intergenic
1199410831 X:147520330-147520352 GAGTTTTATGTCTTATTGTGTGG - Intergenic
1201142814 Y:11042602-11042624 CAGATTGATTTTTAAATGTGGGG + Intergenic
1201346897 Y:12994435-12994457 CAGTTTTTTTTTTAAAAGTGGGG - Intergenic
1201435550 Y:13954548-13954570 GAGCTTTATTTCCAACTATGTGG - Intergenic
1201608308 Y:15812002-15812024 TTTTTTTTTTTTTAACTGTGGGG + Intergenic
1201705410 Y:16931073-16931095 GAGTTTTACTTCTAATTATGTGG - Intergenic
1202033047 Y:20598175-20598197 GAATTTAATTTTTAATTTTGGGG - Intergenic
1202041785 Y:20693291-20693313 GTGCTTTATTTCTAACTATGTGG + Intergenic
1202057920 Y:20855152-20855174 GTGTTTTACTTTGAACTTTGTGG + Intergenic