ID: 1134023720

View in Genome Browser
Species Human (GRCh38)
Location 16:10939415-10939437
Sequence CATACCATGGAGGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134023720_1134023736 29 Left 1134023720 16:10939415-10939437 CCTTCCAGGTCCTCCATGGTATG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1134023736 16:10939467-10939489 GGGCTGTTCTCCAGCCACATGGG 0: 1
1: 0
2: 2
3: 24
4: 229
1134023720_1134023731 9 Left 1134023720 16:10939415-10939437 CCTTCCAGGTCCTCCATGGTATG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1134023731 16:10939447-10939469 CACCTCACTGACCTTTCCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 225
1134023720_1134023735 28 Left 1134023720 16:10939415-10939437 CCTTCCAGGTCCTCCATGGTATG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1134023735 16:10939466-10939488 GGGGCTGTTCTCCAGCCACATGG 0: 1
1: 0
2: 1
3: 28
4: 246
1134023720_1134023728 7 Left 1134023720 16:10939415-10939437 CCTTCCAGGTCCTCCATGGTATG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1134023728 16:10939445-10939467 CCCACCTCACTGACCTTTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 253
1134023720_1134023730 8 Left 1134023720 16:10939415-10939437 CCTTCCAGGTCCTCCATGGTATG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1134023730 16:10939446-10939468 CCACCTCACTGACCTTTCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134023720 Original CRISPR CATACCATGGAGGACCTGGA AGG (reversed) Intronic
901598474 1:10403710-10403732 CATATCATGGATTACTTGGAAGG - Intronic
904367567 1:30024544-30024566 CCAACCATGGGGGACCTGGGTGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906522646 1:46476604-46476626 TACACCATGGAGGGGCTGGAAGG + Intergenic
907661128 1:56393335-56393357 CACGGCATGGAGGACCTGTATGG - Intergenic
908173484 1:61530769-61530791 CATAGGATGCTGGACCTGGAGGG - Intergenic
910289049 1:85582158-85582180 GACCCCATGGAGGACCAGGACGG + Exonic
910296800 1:85655147-85655169 AATATCATGGAGGCACTGGATGG - Intronic
910667562 1:89741506-89741528 CAGACAATGCAGTACCTGGAGGG + Intronic
911346405 1:96701808-96701830 CATACCTTGTAGGTCCTTGAGGG - Intergenic
913371700 1:118106830-118106852 CCTACCTAGGAGAACCTGGAGGG - Intronic
916333006 1:163639282-163639304 CAGACCATGGAGGATTTGTAGGG - Intergenic
917873220 1:179260958-179260980 CACACCTTGAAGCACCTGGAAGG - Intergenic
919777195 1:201201959-201201981 CATCCCATGGAGTTCCTGGCTGG + Intronic
919793271 1:201305924-201305946 CAGAACATGGAGCTCCTGGAGGG + Intronic
920274922 1:204797534-204797556 CAGTCCATGGACGACCTGAACGG - Intergenic
924325789 1:242892696-242892718 CATACTAGAGAGGACCAGGAAGG + Intergenic
1065412207 10:25442016-25442038 CAGACCATGAAGGAGCTAGAAGG + Intronic
1069723329 10:70562892-70562914 CAAATCATGGAGAACCTAGAAGG + Intronic
1071334530 10:84590004-84590026 GAAACCAGTGAGGACCTGGAGGG + Intergenic
1074834849 10:117280933-117280955 CTTACCATTGATAACCTGGAAGG - Exonic
1075686390 10:124367807-124367829 CAGGCCATGGAGGGCCTGGCAGG - Intergenic
1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG + Intronic
1076143390 10:128097198-128097220 CATACCATGGTGGAAATGGGTGG + Exonic
1077097823 11:806557-806579 CCTTCCATGTAGGGCCTGGAGGG + Intronic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1080862224 11:36159843-36159865 CCTACCCTGGAGGGCCAGGACGG + Intronic
1082652785 11:55815191-55815213 CATGCCCTGGAGGAACTGAAGGG + Intergenic
1084782100 11:71416844-71416866 CAGACCATGGAGGTCTGGGAAGG - Intergenic
1086579477 11:88381881-88381903 CACAACATGGATGACCTTGAAGG + Intergenic
1089353257 11:117833416-117833438 CATGTCCTGAAGGACCTGGATGG - Intronic
1090264365 11:125344727-125344749 TATTCCAAGGAGGACCCGGAGGG + Intronic
1091420018 12:329096-329118 AATAAAAGGGAGGACCTGGAGGG - Intronic
1091671779 12:2457208-2457230 GATACCATGGAGAAGCCGGAGGG + Intronic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1101789457 12:107913808-107913830 AATAGCAGGAAGGACCTGGAAGG - Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104575657 12:129963761-129963783 CAACCCATGGAGGCCCTGCAGGG + Intergenic
1106677514 13:31976625-31976647 GACACCATGGTGGCCCTGGAAGG - Intergenic
1108219229 13:48216425-48216447 CACAGCAGGGAGGCCCTGGATGG - Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1114266935 14:21078228-21078250 CAGGCCATTGAGGAGCTGGAGGG + Exonic
1117228214 14:53686076-53686098 CATTTCATGGAGAACCTTGAGGG - Intergenic
1121331947 14:93055320-93055342 CATGCCATGGAGGATTTGCAGGG + Intronic
1121730028 14:96180296-96180318 AATAGCATGGGGGCCCTGGAGGG - Intergenic
1124074686 15:26433591-26433613 AATCCCATAGAGGACCTGGGTGG - Intergenic
1124248783 15:28094456-28094478 CATCGCGGGGAGGACCTGGAGGG - Intronic
1125506674 15:40271440-40271462 CATGCCAGGGAGGAAGTGGAAGG + Intronic
1131653387 15:94427465-94427487 CTTACCATGGTGGGGCTGGAGGG + Intronic
1132635128 16:940409-940431 CATATCATGGAGGACAAGGCAGG + Intronic
1132696414 16:1204120-1204142 CGTGCCCTGGAGGACCCGGAGGG + Exonic
1134023720 16:10939415-10939437 CATACCATGGAGGACCTGGAAGG - Intronic
1138646024 16:58425504-58425526 CATGTCATGGAGGGCCTGGTGGG + Intergenic
1139426667 16:66884786-66884808 CAGACCCTGGAGCACATGGAGGG + Exonic
1139604615 16:68009291-68009313 CATACCATGGAGGCCAGGAAAGG - Intronic
1143676228 17:8435144-8435166 CATTTCTTGGGGGACCTGGAGGG + Intronic
1143782849 17:9238482-9238504 CAGACCAGGGGGTACCTGGAGGG - Intronic
1145828516 17:27896062-27896084 CATAGTATGGAGGACCAGGAAGG - Intergenic
1149862281 17:60128743-60128765 CAGCCCAGGGAGGACTTGGACGG - Intergenic
1150660695 17:67074229-67074251 ACTACCATTGAGGAGCTGGAGGG + Exonic
1157683082 18:49622154-49622176 CAGACCCTAGAGGACCTGGCAGG + Intergenic
1162949285 19:14061247-14061269 AATGCAATGGAGGACCTAGAAGG + Intergenic
1163148396 19:15397561-15397583 AAAACCGTGGAGGACCTTGATGG - Exonic
1164934749 19:32201961-32201983 GAGACAATGGAGGGCCTGGATGG + Intergenic
1165068683 19:33242930-33242952 AACATCATGGAGGAACTGGAAGG + Intergenic
1165736976 19:38183150-38183172 CAGACCATGGAGGGTCTTGAGGG + Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167019172 19:46861306-46861328 CGAACAATGGAGGAGCTGGAGGG + Intergenic
1167768039 19:51497260-51497282 CAGACCTGGAAGGACCTGGATGG - Intronic
1167948046 19:53005126-53005148 CATTATGTGGAGGACCTGGATGG - Intergenic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
927067025 2:19482075-19482097 AATAACATGGATGACCTAGAGGG - Intergenic
928624082 2:33121631-33121653 CATTCCATGGAGGAGCTGGCTGG + Intronic
929979571 2:46666004-46666026 CACACCATGGAAGGCCTGGCTGG - Intergenic
930007254 2:46907946-46907968 CATATCATGGAGCATCTAGAAGG - Exonic
932128459 2:69166614-69166636 CATAACATGGAAGAACTGGATGG - Intronic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
936777144 2:115987341-115987363 CATATCAAGGAGGACCTGAGTGG + Intergenic
938341502 2:130539474-130539496 CATGCCCTGGAGGACCCGAATGG + Exonic
938348328 2:130581235-130581257 CATGCCCTGGAGGACCCGAATGG - Intronic
947937769 2:234022743-234022765 CAATCCATGGAGGACCTGAATGG - Intergenic
948647042 2:239411851-239411873 CAGACCAGGGAGGTCCTGGGGGG + Intergenic
1169933527 20:10858646-10858668 CATAGCAGAGAGGAGCTGGAAGG + Intergenic
1171024752 20:21619736-21619758 CATTTCATTGAGGACATGGATGG + Intergenic
1171381605 20:24737981-24738003 GATTCCAGGAAGGACCTGGAAGG + Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1175547884 20:59791057-59791079 CATACCATGGTGGAGCTGAAAGG - Intronic
1175686121 20:61030033-61030055 CACACTATGGAGAACCAGGAGGG + Intergenic
1180181181 21:46119316-46119338 AACACCATGGAGGACCTGCCTGG - Intronic
1181516105 22:23414745-23414767 CAGCCCAAGGAGGTCCTGGAGGG + Intergenic
1181874579 22:25930184-25930206 CAGCCCATGGAGGACCAAGAGGG - Intronic
1184230566 22:43156245-43156267 CATACAACGGGGGACCTGGATGG + Intronic
950449657 3:13058571-13058593 CATCCAGGGGAGGACCTGGAGGG + Intronic
952877051 3:37954807-37954829 AAGACCATGGAGGACCTTTAAGG + Intronic
953976653 3:47386558-47386580 CATCCCATGGAAAATCTGGAAGG - Intronic
955075882 3:55612719-55612741 CTTACCATGGATGACCTTGATGG - Intronic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
958744699 3:98118757-98118779 CTCACCATGGAGAAACTGGAAGG - Intergenic
958803665 3:98784119-98784141 CATGCCATGAGGGCCCTGGAAGG + Intronic
959027308 3:101254969-101254991 CTTACCATGGTGGAGCAGGAGGG - Intronic
959077764 3:101768153-101768175 CATACCATGTAAGAGTTGGAAGG + Exonic
961939865 3:130625682-130625704 CATACCATGTGGATCCTGGATGG + Intronic
963087561 3:141452477-141452499 CATACCATGCAGAACCTTCAAGG + Intergenic
964052816 3:152417559-152417581 CAAACCTTGGAGGAGCAGGAAGG + Intronic
968595317 4:1479285-1479307 CAAGCCATGGAGGACATTGAAGG - Intergenic
969218087 4:5739091-5739113 CATACCATGGAGGTATTGTAGGG - Intronic
969314407 4:6372812-6372834 CAGACCACGGAGGATCAGGATGG - Intronic
975188480 4:71431484-71431506 AAGACCATGGAGGACATGGAGGG + Intronic
978096282 4:104782794-104782816 TATACCATGTAAGTCCTGGAAGG + Intergenic
983449799 4:167895532-167895554 TATACCATGGGGGATATGGAAGG - Intergenic
984102124 4:175499369-175499391 CAGACCAGGGAGGGCCTGAAGGG - Intergenic
986166298 5:5274332-5274354 CAGAGCATGGAGGATCTGCAGGG - Intronic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
988315204 5:29617657-29617679 CATACAATGGATGAAATGGAAGG + Intergenic
988489933 5:31697706-31697728 GGTACCATGGAGCAGCTGGAGGG - Intronic
990523297 5:56600626-56600648 CATAACAGGGAGGCACTGGAAGG + Intronic
991933601 5:71780820-71780842 CAGAGCATGGAGGGCCTGGCAGG - Intergenic
994074528 5:95635593-95635615 GATACCATGGTGGATCTGGATGG - Intergenic
994618825 5:102138443-102138465 CATTCCATGGAGGCCCTGGGAGG + Intergenic
994806649 5:104456868-104456890 TACACCATGGAGGACTTAGATGG - Intergenic
996301671 5:121994864-121994886 CATACCTTTAAGGACCTCGAAGG - Intronic
997152209 5:131510076-131510098 CAGCCCAGGGAAGACCTGGATGG + Intronic
997885979 5:137630298-137630320 CCTACACTGGAGGACCTGGAGGG - Intronic
998604968 5:143624001-143624023 CTTACCATTGAGGACCAGCAGGG + Intergenic
1001504483 5:172266421-172266443 CATGCCAAGAAGGACCTGGTAGG - Intronic
1002098826 5:176847363-176847385 CATAGAAGGGAGGCCCTGGAGGG - Intronic
1002854567 6:1025902-1025924 CAAACCCTGGAGGACTCGGAGGG - Intergenic
1005806652 6:29479544-29479566 CATACCTGGGAGGACTTGGACGG + Intergenic
1007434429 6:41798621-41798643 CATCCCATGGATTACCTAGAGGG - Intronic
1007829949 6:44630364-44630386 CATAGCATGTAAGAGCTGGAAGG + Intergenic
1008346154 6:50429184-50429206 CATACCATTGAAATCCTGGATGG + Intergenic
1008578753 6:52886168-52886190 CATGACAGGGAGGACCAGGAAGG + Intronic
1010053063 6:71531146-71531168 AATATCTTGGAGGAGCTGGAGGG + Intergenic
1010751369 6:79619518-79619540 AATACCAATGAGGACCAGGAGGG - Intergenic
1013327526 6:109062417-109062439 CACACCATGGAGGGCCTTGCAGG + Intronic
1013663379 6:112321964-112321986 CATCCCATGGAGAAAATGGATGG - Intergenic
1013702529 6:112790611-112790633 CAAACCATGAAGGGCCTTGAAGG - Intergenic
1018090246 6:160340387-160340409 CATTCCGTGGAGGACAAGGAGGG + Intergenic
1018218740 6:161557805-161557827 CTTAGCTTGGAGGACCTGAAAGG - Intronic
1019268886 7:134844-134866 CATCTCATGGAGGAACTGGGAGG - Intergenic
1019355957 7:579108-579130 CACCCCATGGAGGCCCCGGACGG + Intronic
1023362576 7:39431592-39431614 CACAGCATGGAGGACCTTGGAGG - Intronic
1023888844 7:44378516-44378538 CCCACCTTGGAGGACCAGGAGGG + Intergenic
1024230723 7:47361295-47361317 CCCACCATGGAGGGCCAGGATGG - Intronic
1026644522 7:72156165-72156187 CAAACCAAGGAGAACCTGGAAGG + Intronic
1026656633 7:72262256-72262278 CATCACACGGAGGACTTGGAAGG + Intronic
1028218617 7:88166990-88167012 CATCCCACAGAGGACCTGGCAGG + Intronic
1028510578 7:91621008-91621030 CAGAGCATGGAGGGCCTGGGAGG - Intergenic
1028824300 7:95252073-95252095 GATACCATGGAGAACTTGGATGG + Exonic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1030199783 7:106890992-106891014 CATGCAATGAAGGACCTGGCAGG - Intronic
1030212070 7:107006412-107006434 CATAACATGGTAGACCTGAAGGG - Intergenic
1032322247 7:130896074-130896096 CATCCTGTGGAGGCCCTGGACGG + Intergenic
1033363015 7:140651237-140651259 GATACCAAGCAGGACCTGGGGGG + Intronic
1034469280 7:151246987-151247009 CAGAGCCTGGAGGACCAGGAGGG - Intronic
1035549985 8:514831-514853 CATTCCTTGGAGGACCAGGGTGG - Intronic
1035623264 8:1051117-1051139 CATTCCATGATGGCCCTGGATGG + Intergenic
1035644887 8:1211016-1211038 CACACCAGGGAGGACCTGGCAGG + Intergenic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1042768971 8:72358036-72358058 CAGACCATGGAGAACTTGAAAGG - Intergenic
1043869202 8:85412348-85412370 CATACCATAGAGCACCTGTTGGG - Intronic
1043938964 8:86174881-86174903 CTTACCATGAAAGACTTGGAAGG - Intergenic
1049653319 8:143786782-143786804 CATACAAGGGAGAACTTGGAGGG + Intergenic
1049774089 8:144396753-144396775 CAGCCCCTGGAGGACCTGCATGG - Intronic
1050596975 9:7213766-7213788 CAGAGCATGGAGGCCTTGGAAGG - Intergenic
1051839992 9:21385084-21385106 CATCTCATGGAGGACAGGGATGG + Exonic
1052173985 9:25434314-25434336 CACACCATTGAGAACCAGGAAGG + Intergenic
1052181820 9:25538232-25538254 CAAACCATGTAAGACTTGGAAGG - Intergenic
1052875051 9:33553063-33553085 CATTCCATGGAACACCTGGTTGG + Intronic
1053062526 9:35043401-35043423 CATACTATGGAAGATCTAGAAGG + Exonic
1053305023 9:36978415-36978437 TATACCTGGAAGGACCTGGAAGG + Intronic
1053500969 9:38591263-38591285 CATTCCATGGAACACCTGGTTGG - Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1056450996 9:86716629-86716651 CATCCTACAGAGGACCTGGAGGG - Intergenic
1057680378 9:97175772-97175794 CATTCCATGGAACACCTGGTTGG - Intergenic
1058672595 9:107372822-107372844 CAGGCCATGAAGGACCTGAAAGG + Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059154379 9:111976929-111976951 CATACCAGGCTGGTCCTGGAGGG + Intergenic
1061193097 9:129093693-129093715 CAGACAATGGAGGAAATGGATGG - Intergenic
1061196959 9:129111715-129111737 CATGACACGGAGGAACTGGAGGG + Intronic
1062082191 9:134629997-134630019 CACAGCATGGGGCACCTGGAAGG - Intergenic
1062628234 9:137452548-137452570 CATACCAAGGATGTCCTCGAAGG + Exonic
1203435147 Un_GL000195v1:130925-130947 CATCTCAGGAAGGACCTGGAAGG + Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1197007662 X:121522052-121522074 CATACAATGGAGGAATTGTATGG + Intergenic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1201223238 Y:11791236-11791258 CATACTAGAGAGGACCAGGAAGG + Intergenic
1201368472 Y:13234885-13234907 CAGGCCAGGGAGGACCTGAAGGG - Intergenic
1201783885 Y:17752327-17752349 CAAACCATGGAGGAGCTTGGAGG - Intergenic
1201817668 Y:18153660-18153682 CAAACCATGGAGGAGCTTGGAGG + Intergenic