ID: 1134023843

View in Genome Browser
Species Human (GRCh38)
Location 16:10940264-10940286
Sequence TCACGAAGGCAGAGCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 4, 2: 27, 3: 122, 4: 448}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134023835_1134023843 22 Left 1134023835 16:10940219-10940241 CCAAATGATGGTATTGCGGGGTG 0: 1
1: 0
2: 0
3: 41
4: 976
Right 1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG 0: 1
1: 4
2: 27
3: 122
4: 448
1134023834_1134023843 23 Left 1134023834 16:10940218-10940240 CCCAAATGATGGTATTGCGGGGT 0: 1
1: 0
2: 1
3: 38
4: 444
Right 1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG 0: 1
1: 4
2: 27
3: 122
4: 448
1134023841_1134023843 -4 Left 1134023841 16:10940245-10940267 CCTTAGGGAGGTGATTAGGTCAC 0: 1
1: 36
2: 457
3: 1251
4: 2311
Right 1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG 0: 1
1: 4
2: 27
3: 122
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134023843 Original CRISPR TCACGAAGGCAGAGCCTTCA TGG Intronic
900610027 1:3540774-3540796 TCCCCACGGCAGAGCCTTCCTGG + Intronic
900793442 1:4693862-4693884 TCAAGGGGGCAGAGCCTTCAGGG + Intronic
900871950 1:5310666-5310688 TCATGGAGGCAGAATCTTCACGG + Intergenic
901783765 1:11611059-11611081 TCAGGAAGGCAGAGCCTCCCAGG - Intergenic
901945255 1:12697008-12697030 TTATGATGGCAGAGCCCTCATGG + Intergenic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
903002063 1:20273643-20273665 ACAAAAAGGCAGAGCCCTCAAGG - Intergenic
903775519 1:25790927-25790949 TCACAAGGGCAGAGCCCTCATGG - Intergenic
905436618 1:37960269-37960291 TCTCAAAGGCAGAGTCTTCTAGG - Intronic
905491821 1:38350274-38350296 TCATGAGGGTGGAGCCTTCATGG + Intergenic
905530659 1:38676139-38676161 TCATGAAGTCAAAGCCTTCATGG + Intergenic
906316087 1:44787111-44787133 ACACGGTGGCAGAGCCTTCCTGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906672996 1:47671594-47671616 TCATGAAGGAGGAGCCCTCATGG + Intergenic
906873665 1:49512454-49512476 TCATGGGGGCAGATCCTTCATGG + Intronic
906911304 1:49954352-49954374 TCATGAGGGCAGAGCCCTCATGG - Intronic
907291995 1:53421193-53421215 TCATGAGGGCAGAGCCCTCATGG + Intergenic
907598677 1:55745083-55745105 TCATGAGGGAGGAGCCTTCATGG + Intergenic
907979692 1:59469473-59469495 TCATGAGGGCAGAGCCCTCATGG + Intronic
908171162 1:61506038-61506060 TCATGAGGGCCGAGCCATCATGG + Intergenic
908594972 1:65678258-65678280 TAATGAGGGCAGAGCCCTCATGG + Intergenic
908669202 1:66527381-66527403 TCACGAGGGAGGAGCCCTCATGG - Intergenic
909139612 1:71846844-71846866 TCATGAGGGTAGAGCCCTCATGG - Intronic
909573111 1:77140136-77140158 TCATGAGGGCAGATCCCTCATGG + Intronic
909756273 1:79230029-79230051 TCATGGGGGCAGATCCTTCATGG - Intergenic
909792065 1:79692487-79692509 TCATGAGGGCAGATCCTTCACGG + Intergenic
909885588 1:80939035-80939057 TAATGATGACAGAGCCTTCATGG + Intergenic
910544548 1:88398924-88398946 TCATGAAGACAGAGCCCTCATGG - Intergenic
911138152 1:94465179-94465201 TCATGGAGGCAGATCCCTCATGG - Intronic
911270449 1:95795368-95795390 TCAAGAGGGTAGAGCCCTCATGG + Intergenic
912093283 1:106108434-106108456 TGATGAGGGCAGAGCCCTCATGG + Intergenic
912124043 1:106510859-106510881 TCATGGAGGCAGATCCCTCATGG - Intergenic
912138077 1:106685586-106685608 TAATGAAGGCAGGGCCCTCATGG - Intergenic
912786692 1:112610647-112610669 TCATGAGGGCAGTGCCCTCAGGG - Intronic
913099664 1:115551419-115551441 TCATGATGGCAGAGCCCACATGG - Intergenic
916801285 1:168218958-168218980 TCATGAGGGCAGAGTCCTCATGG + Intergenic
916850661 1:168700179-168700201 TCATGAGAGCAGAGCCCTCATGG - Intronic
917161887 1:172066539-172066561 TCATGATGGCAGAGCCTTCATGG + Intronic
917926738 1:179795409-179795431 TTACAAAGGCACAGCCCTCATGG - Intronic
918748010 1:188231055-188231077 TCATGAGGGCAGAGACTTCATGG + Intergenic
920159564 1:203985908-203985930 TCATGAGAGCAGAGCCCTCATGG + Intergenic
920275419 1:204800843-204800865 TCATGAGGGCAGAGTCCTCATGG - Intergenic
920790126 1:209082119-209082141 TCACAAGGGAAGAGCCTTCATGG + Intergenic
920790341 1:209084041-209084063 TCATGAGGGCAGAGTCTTAATGG - Intergenic
921422733 1:214967231-214967253 TCACGAGGACAGAGCTCTCATGG + Intergenic
921718992 1:218449848-218449870 TCATGGAGGCAGAGCCTTTATGG - Intergenic
922025683 1:221746453-221746475 TCATGAGGGCAGAGGCCTCATGG + Intergenic
922110318 1:222549259-222549281 TCATGAAGGCAGAGGCCTCATGG - Intergenic
922782780 1:228266503-228266525 TCTCAAAGGCAAAGCTTTCAAGG - Intronic
923319468 1:232816370-232816392 TCATGAGGACAGAGCCCTCATGG + Intergenic
923676922 1:236088312-236088334 TCATGAGGGCAGAGCCCTCATGG + Intergenic
924542407 1:244993843-244993865 TCATGAGGGCAGAGCCCTCGTGG + Intronic
924690738 1:246347642-246347664 CCATGAGGACAGAGCCTTCATGG - Intronic
924920378 1:248622917-248622939 TCACTCAGGCAGAGCCCCCATGG + Intergenic
1062778061 10:172124-172146 TCATGAGGGCAGAGCCCCCATGG + Intronic
1063001545 10:1928782-1928804 TGACGAAAGCAGAGAATTCAAGG + Intergenic
1065136780 10:22678919-22678941 TTAAAAAGGCAGATCCTTCAAGG - Intronic
1065640210 10:27774418-27774440 TCATGAGGTCAGAGCCCTCATGG + Intergenic
1065663425 10:28030912-28030934 TCATGAGGGCAGAGCCCTTATGG - Intergenic
1065863515 10:29892508-29892530 TCATGAGGGCAAAGCCCTCATGG + Intergenic
1065924737 10:30425573-30425595 TCCCAAAGGAAGAGCCCTCATGG - Intergenic
1067141780 10:43663828-43663850 TTATGAGGGCAGAGACTTCATGG + Intergenic
1067162333 10:43837807-43837829 TCATGAAGGCAGAACCCTCATGG + Intergenic
1067162665 10:43840477-43840499 TCATGAAGGCAGAGCCCTAATGG + Intergenic
1067929066 10:50541485-50541507 TCATGAAGACAGAGCCTGGATGG - Intronic
1067989504 10:51194929-51194951 TCATGAGGGCAGAGTCTTCATGG + Intronic
1068282808 10:54898041-54898063 TCATGAGGGCAGATCCCTCATGG + Intronic
1068382022 10:56267399-56267421 TCATGAGGGCAGAGTCTTCATGG - Intergenic
1068424803 10:56846204-56846226 TCATGAAGGCAGAGCTTTCATGG - Intergenic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1068428850 10:56906380-56906402 GCAAGAAGGCAGAAACTTCAAGG - Intergenic
1069134127 10:64742772-64742794 TCATGAGGGCAGAGCTTTCCTGG + Intergenic
1071398901 10:85250218-85250240 TCATGAGGGCATAGCCCTCATGG + Intergenic
1071978938 10:90984079-90984101 TCACCAAGGCAGAGCTTTGCAGG - Intergenic
1072021140 10:91403117-91403139 ACATGAAGACAGAGCCCTCATGG + Intergenic
1072634056 10:97165907-97165929 TCACCAAGGCAGACCATTCCAGG + Intronic
1073703718 10:105958889-105958911 TCATGAAGGTAGAGTCTTTATGG - Intergenic
1073825619 10:107317204-107317226 TAATGAAGGCTGAGACTTCAGGG + Intergenic
1074244971 10:111680634-111680656 TCATGAGGGCAGATCCCTCAAGG - Intergenic
1074444466 10:113507987-113508009 TCATGAGGACAGAGGCTTCATGG - Intergenic
1075067264 10:119297567-119297589 TCATAATGGCAGAGCCCTCATGG - Intronic
1075810630 10:125222358-125222380 TGATGAAGGCAGAGCCCTCATGG - Intergenic
1077719529 11:4613719-4613741 TCATGAGGGCAGAGCCCTCCTGG + Intergenic
1077931104 11:6733968-6733990 ATAGGAAGGCAGAGCCCTCATGG - Intergenic
1078470918 11:11585941-11585963 TCATGAGGGTAGAGCCCTCATGG + Intronic
1078496402 11:11821886-11821908 TCATGAAGACAGAGCCTTCGTGG + Intergenic
1078568602 11:12438497-12438519 TCATGAGGGCTGAGCCTTCATGG + Intronic
1078824605 11:14916988-14917010 TCATAAGGGCAGAGCCCTCATGG + Intronic
1078837939 11:15049550-15049572 CCATGAGGGAAGAGCCTTCATGG + Intronic
1079174940 11:18131116-18131138 TCACTTAGGCAAAGACTTCATGG + Intronic
1079178504 11:18167125-18167147 TCACTTAGGCAAAGACTTCATGG + Intronic
1079249712 11:18778512-18778534 TCACGGAGGCAGATCCTGCATGG + Intronic
1079737462 11:24014064-24014086 TCATGGAGGCAGATCCCTCATGG + Intergenic
1080352958 11:31405969-31405991 TCATGAGGGCAGAGCAGTCATGG + Intronic
1080626704 11:34037120-34037142 TCCCCAAGGCAAAGCCTTAATGG + Intergenic
1081555459 11:44156980-44157002 TCACGAAGGTACAGCCTTGGTGG + Intronic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1083771092 11:64867980-64868002 TCAGGAAGGCAGACCCTGTAAGG - Intronic
1084492116 11:69484552-69484574 TCACAAAGGCACAGCTTTTAAGG + Intergenic
1084927292 11:72523660-72523682 TCAGTAAGGCAGAGCAGTCATGG + Intergenic
1084938294 11:72599006-72599028 TGATGAAGGCTGAGGCTTCACGG + Intronic
1087097163 11:94330275-94330297 TCATGACGGCAAAGCCCTCATGG - Intergenic
1087462326 11:98461458-98461480 TCATGAGGGCAGTGCCTTCACGG + Intergenic
1089143814 11:116309768-116309790 TCATGAGGGCAGAGCACTCAAGG + Intergenic
1089597154 11:119587816-119587838 TCATGAAGGCAGACCCCTCATGG - Intergenic
1090131439 11:124146442-124146464 TCACAAAGACAGAGACTGCAGGG + Exonic
1090152582 11:124401306-124401328 TCACGAGGGGAGAACCCTCATGG + Intergenic
1090746626 11:129710640-129710662 TCTGGAAGGCAGAGCTTTCCTGG - Intergenic
1091341132 11:134814839-134814861 TCATGAAGGCAGAGGCTTCCAGG - Intergenic
1091747303 12:3000540-3000562 TCGTGAAGGCAGTGCCTTCAGGG + Intronic
1091774629 12:3176303-3176325 TGGGGAAGGAAGAGCCTTCATGG + Intronic
1091897368 12:4116407-4116429 TGAGGGAGGCAGAGCCTGCAGGG + Intergenic
1092747959 12:11691176-11691198 TCATGAGGGTAGAGCCCTCATGG - Intronic
1092927287 12:13282847-13282869 TCATGAGGACAGAGCCCTCATGG + Intergenic
1093486181 12:19655645-19655667 TCACAAGGGCAGAGCCCCCATGG - Intronic
1093525022 12:20095313-20095335 TCATGAAGGTACAGCCTGCATGG + Intergenic
1093959961 12:25261720-25261742 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1094756661 12:33477722-33477744 TCGTAAGGGCAGAGCCTTCATGG + Intergenic
1095717302 12:45360418-45360440 TCATGAAGGATGAGCCCTCATGG + Intronic
1096383908 12:51181899-51181921 TCTTGGAGGCAGAGCCTTCTGGG - Intergenic
1096896174 12:54822238-54822260 TCATGAAGGCAGAGCCCTCTTGG - Intergenic
1097370471 12:58773085-58773107 TCACAAAGGCAAAGCCTTCATGG - Intronic
1097705039 12:62859634-62859656 TCACATATGCAAAGCCTTCAAGG + Intronic
1097796597 12:63869337-63869359 TCAGGAAGGCAAACCCCTCATGG + Intronic
1098612409 12:72476412-72476434 TCGTGCTGGCAGAGCCTTCAAGG - Intronic
1099675489 12:85755701-85755723 CCACAGAGGCAGAGCCCTCATGG + Intergenic
1100339643 12:93666163-93666185 TCATGAGGGCGGAGCCCTCATGG + Intergenic
1100571351 12:95845892-95845914 TCACGAGGGCAGATCCTTTATGG - Intergenic
1100591876 12:96037011-96037033 TCACGGGGGCAGAGCCCTCATGG - Intronic
1101104830 12:101429412-101429434 TCATGAAAGCAGAGCCCTCATGG - Intergenic
1101207708 12:102505326-102505348 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1105825208 13:24116296-24116318 TCATGAAAGCAGAGTCCTCATGG - Intronic
1105934158 13:25083294-25083316 TCATGAGGGCAGAGTCATCATGG + Intergenic
1105968048 13:25402713-25402735 TCTCAAAGGCGGAGCCCTCAGGG - Intronic
1107270482 13:38610396-38610418 TTATGAAGGCAGAGGCCTCATGG + Intergenic
1107542477 13:41403947-41403969 TCATGAAGGTAGAGCCCTCTTGG - Intergenic
1107785467 13:43952280-43952302 TCATGAAGGCAGAGCCTTTGTGG - Intergenic
1108601685 13:52000386-52000408 TCGAGAAGGCAGAGCCCTCATGG + Intronic
1109179753 13:59199675-59199697 TCAGAAAAGCAGAGCCATCATGG + Intergenic
1109383107 13:61591052-61591074 TAATGAGGGCAGAGCCTTCATGG - Intergenic
1110286809 13:73759255-73759277 CCAAGAATGCAAAGCCTTCATGG - Intronic
1110325293 13:74207199-74207221 TCATGAGGACAGAGCCCTCATGG + Intergenic
1110753696 13:79146282-79146304 TCACAAGGGCAGAGCCCTCAGGG - Intergenic
1110823723 13:79947187-79947209 TCATGAGGGAGGAGCCTTCATGG - Intergenic
1111316376 13:86566615-86566637 CAATGAAGGCAGAGCCCTCATGG - Intergenic
1111490270 13:88963118-88963140 TCACGAGGGAGAAGCCTTCATGG + Intergenic
1111759454 13:92443263-92443285 TCATGCAGGCAGAGCCCTCATGG - Intronic
1112074721 13:95899029-95899051 TCATGAGGGCAGAGCCCTCGTGG - Intronic
1112118086 13:96379318-96379340 TCATGAGGGCAGAGCCCTCCCGG + Intronic
1112223962 13:97519165-97519187 TCATGGAGGCAGATCCCTCATGG - Intergenic
1112615882 13:101004962-101004984 TCAGGAGGTCACAGCCTTCAGGG - Intergenic
1113069066 13:106401446-106401468 GCACGAAGCCAGACCCATCAGGG + Intergenic
1113273483 13:108701345-108701367 TCATGAGGGCAGAGTCCTCATGG - Intronic
1113761038 13:112846808-112846830 TCACGAAGGCATGGCCTGAAAGG - Intronic
1113810095 13:113135556-113135578 TCACAAGGGCAGAGCCTTCATGG + Intronic
1114639164 14:24207522-24207544 TAAGGAGGGCTGAGCCTTCAGGG + Intronic
1115114651 14:29865448-29865470 TCATGAGGGCAGAGCCCTCAAGG - Intronic
1115840936 14:37469690-37469712 TCATGAGGGCAGAGCCCTCATGG - Intronic
1115941031 14:38609865-38609887 TCATGAAGGGAGAGCATTCATGG + Intergenic
1116428391 14:44818374-44818396 TCCAGAGGGCAGAGCCCTCATGG - Intergenic
1116439985 14:44940214-44940236 TCATGAGAGCAGAGCCCTCATGG + Intronic
1117222703 14:53621549-53621571 CCATCAAGGGAGAGCCTTCATGG + Intergenic
1117364530 14:55012810-55012832 TCATGAGGCCAGAGCCCTCATGG + Intronic
1117456795 14:55905908-55905930 TCACGCGGGCAGATCCCTCATGG - Intergenic
1117477516 14:56111507-56111529 TCATGGGGGCAGAGCCCTCATGG + Intergenic
1117637670 14:57762618-57762640 TCATAAGGGCAGAGCCCTCATGG - Intronic
1118050898 14:62026519-62026541 TCAGGAAGGAGGAGCCCTCATGG + Intronic
1118700175 14:68425395-68425417 TCATGAGGGCAGGGCCCTCATGG - Intronic
1119277304 14:73370158-73370180 TCATGTGGGCAGAGCCCTCATGG - Intronic
1119556637 14:75558460-75558482 TCATGAGGACAGAGCCCTCATGG - Intergenic
1119756903 14:77125837-77125859 TCACAAACTCAAAGCCTTCAGGG + Intronic
1120583009 14:86277651-86277673 TCAGGAGGGCAGAGCACTCATGG - Intergenic
1121069908 14:91009209-91009231 TCACTAGGGCAGAGCCCTCATGG + Intronic
1122555223 14:102575267-102575289 TCATGAGGGCAGAGCCCTCACGG - Intergenic
1122682435 14:103475971-103475993 TCATGAAGGCGGAGCCCTCGTGG + Intronic
1123013213 14:105359224-105359246 TGACGATGGCAGAGCCTGCGGGG - Intronic
1123580014 15:21706450-21706472 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1123616662 15:22149072-22149094 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1124431138 15:29609437-29609459 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1124839178 15:33225983-33226005 TCATGAAGGCAGAGCCCTTGAGG + Intergenic
1126656063 15:50979322-50979344 TCATGAAGGCAGATTCCTCATGG - Intronic
1127284125 15:57517769-57517791 TCATAAGGGCAGAGCCCTCATGG + Intronic
1127670159 15:61187438-61187460 TCAAGGAGGAAGAGCCTCCAGGG + Intronic
1128086828 15:64892521-64892543 TCATGAGGGCAGAGTCCTCATGG - Intronic
1128591799 15:68904568-68904590 TCACGAGGGAGGAGCCTCCATGG + Intronic
1129168088 15:73790602-73790624 TCATGAGGGCAGAGCCCTTATGG + Intergenic
1129255403 15:74331343-74331365 CCAGGAAGGCAGGGCCTCCAGGG - Intronic
1129582550 15:76827962-76827984 TCATGAGAGCAGAGCCCTCATGG - Intronic
1129747708 15:78036443-78036465 TCGTGAAGACTGAGCCTTCATGG - Intronic
1130689721 15:86071363-86071385 TCACGAAGGCTCTGCCTTCATGG + Intergenic
1131054961 15:89369595-89369617 TCACTAAGGGAGAGGCTCCAGGG - Intergenic
1131948743 15:97656998-97657020 TTATGAGGGCAGATCCTTCATGG - Intergenic
1202988884 15_KI270727v1_random:440695-440717 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1133336673 16:5011022-5011044 TCAAGGAGGCTGAGCCTTCATGG - Intronic
1133466728 16:6034579-6034601 GCATGAAGGCAGAGTCTTCATGG + Intronic
1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG + Intronic
1134238808 16:12488757-12488779 CAACTAAGGCAGAGTCTTCATGG - Intronic
1134909938 16:18016319-18016341 TTATGAGGGCAGAGCCCTCATGG + Intergenic
1135059860 16:19262254-19262276 TCATGAGGACAGAGCCTTCATGG - Intronic
1135145802 16:19961784-19961806 TCATGAGGGCAGAGCATCCATGG - Intergenic
1136067858 16:27770845-27770867 TCATGAAGCCAAAGCCATCAGGG + Intronic
1136646778 16:31626781-31626803 TCATGCAGGCAGAGCTCTCATGG - Intergenic
1136658398 16:31729504-31729526 TCATGCAGGCAGAGCTCTCATGG + Intronic
1137932247 16:52600129-52600151 TCATCAGGGCAGAGCCCTCACGG + Intergenic
1138241161 16:55428215-55428237 TCTTGAAGGCAGAGCCTTTATGG - Intronic
1138747769 16:59383415-59383437 TCATGAGGGCAGAGTCCTCATGG + Intergenic
1138996112 16:62454934-62454956 TCATGGGGGCAGATCCTTCATGG + Intergenic
1139320754 16:66111936-66111958 CCACAAGGGCAGAGCCCTCATGG - Intergenic
1140752571 16:78039323-78039345 TCATGAGGGCAGAGCTCTCATGG + Intronic
1141637253 16:85320814-85320836 GCAAGAAGGCAGTGCCTCCAGGG - Intergenic
1142929658 17:3272018-3272040 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1144125916 17:12202766-12202788 TCATGAGAGCAGAGCCATCATGG + Intergenic
1144957840 17:19028374-19028396 TCACGCAGTCAGGGCCTTCTTGG + Intronic
1144977318 17:19146146-19146168 TCACGCAGTCAGGGCCTTCTTGG - Intronic
1149216843 17:54366168-54366190 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1149440938 17:56673346-56673368 TCATGAGGGGAGAGCCCTCATGG + Intergenic
1150129424 17:62659169-62659191 TCATTAGGGAAGAGCCTTCATGG - Intronic
1150545640 17:66154903-66154925 TTATGAGGGCAAAGCCTTCATGG - Intronic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1150686884 17:67328041-67328063 TCATGAGGGCACAGCCCTCATGG - Intergenic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1150981028 17:70141738-70141760 TCATGAAGGCAGAGCCTCCATGG + Intergenic
1151784658 17:76269656-76269678 TAAGGGAGGCAAAGCCTTCAAGG + Intronic
1152064783 17:78104838-78104860 TGATGATGGCAGAGCCTACAGGG - Exonic
1152477116 17:80525662-80525684 TCACGAGGGTGGAGACTTCACGG - Intergenic
1153571971 18:6482756-6482778 TCACGAGGGAAGGGCCTGCAGGG + Intergenic
1153963118 18:10156930-10156952 TTATGAAGGAAGAGCCCTCATGG - Intergenic
1154147200 18:11875996-11876018 TCACGAGGGCTCCGCCTTCATGG - Intronic
1155026676 18:21946995-21947017 TCATTAGGGCAGAGCCCTCATGG - Intergenic
1155324154 18:24649351-24649373 TCATGAAGGAGGAGCCCTCATGG + Intergenic
1155631890 18:27904205-27904227 TCACGAAGGTAGAGCCCTTATGG - Intergenic
1155776249 18:29765631-29765653 TCATAAAAGCAGAGCCCTCATGG - Intergenic
1156018112 18:32569214-32569236 TCATGATGGCAGAGCCCTCATGG + Intergenic
1156069872 18:33194020-33194042 CCATGAAGGCAGAGCACTCATGG + Intronic
1157392302 18:47312929-47312951 TCAAGAATGCAGAGCGGTCAAGG + Intergenic
1157436896 18:47677957-47677979 TCATAAGAGCAGAGCCTTCATGG + Intergenic
1158048510 18:53186981-53187003 TCATGAGGGTAGAGCCCTCATGG + Intronic
1158089080 18:53689626-53689648 TCATGAAGGCAGAGCTCTCATGG + Intergenic
1158429826 18:57375378-57375400 TCATGAAGGTAGAGACCTCATGG + Intergenic
1158638198 18:59179678-59179700 TCATGAGGACTGAGCCTTCATGG - Intergenic
1158891747 18:61878789-61878811 TCACAAGGGCAGAGCCTTCATGG + Intronic
1158992051 18:62879189-62879211 TCATGAAGGTAGAGCCCTCATGG - Intronic
1160337618 18:78056865-78056887 TCATGAAGGAGGAGACTTCATGG - Intergenic
1162361750 19:10224563-10224585 TGATGAAGGCAGAGCCCTCCCGG + Exonic
1162464539 19:10832016-10832038 CCCCGAAAGCAGAGCCCTCAGGG - Intronic
1164429010 19:28170371-28170393 TGACTAAGGCAGGGCCTCCATGG - Intergenic
1165251943 19:34545982-34546004 TCATGACGGCAGAGCCCTCAAGG - Intergenic
1165268494 19:34682176-34682198 TCATGAGGGCAGAGTCCTCAAGG + Intronic
1165274708 19:34738387-34738409 TCATGAGGGCAGAGCCCTCAAGG + Intronic
1165529659 19:36387381-36387403 TCATGAAAGCAGAGTCCTCATGG - Intronic
1166998942 19:46733553-46733575 TCAACAGGGCAGAGCCTTAAGGG + Intronic
925563355 2:5222540-5222562 TCAGGTTGGCTGAGCCTTCAGGG + Intergenic
926672238 2:15587347-15587369 TCATGAGAGCAGAACCTTCATGG - Intergenic
927057064 2:19375125-19375147 CCATGATGGCAGAGCCCTCATGG + Intergenic
927466087 2:23337737-23337759 TCACAAGGGAAGAGCCCTCACGG - Intergenic
927943549 2:27120856-27120878 TCATGAGGGGAGAGCCCTCATGG - Intergenic
928182061 2:29075146-29075168 TCAGGAAGGCAATGCTTTCATGG + Intergenic
930746863 2:54893468-54893490 TCATGAGGGCAGACCCCTCATGG + Intronic
931937798 2:67217427-67217449 TCATGAAGGCAGTGCCATCATGG - Intergenic
932365610 2:71151176-71151198 TCTTGAAGGCAGAGCCCTCATGG - Intergenic
932966362 2:76480122-76480144 TGACAAAGGCAGAAGCTTCACGG - Intergenic
933036728 2:77409452-77409474 TCACAAGGGAAGAGCCTTCATGG + Intronic
933345817 2:81084349-81084371 CCAGGAAGGCAGAGGTTTCAGGG + Intergenic
933749556 2:85594398-85594420 CCAGGGAGGCAGTGCCTTCAGGG + Intergenic
933850784 2:86364945-86364967 TCATGAGGGCAGATCCCTCATGG - Intergenic
934706419 2:96484736-96484758 TCATGAGGGCAGAGGCTTCATGG - Intergenic
935604026 2:104951746-104951768 TCACTAAGCCAGTGTCTTCAAGG + Intergenic
935764397 2:106351205-106351227 TCACAAAGGAAAAGCCCTCATGG - Intergenic
936168694 2:110148172-110148194 TCATGAGGGCAGATCCCTCATGG + Intronic
936592712 2:113819398-113819420 TCATGAGGGTAGAGCCCTCATGG - Intergenic
937653189 2:124344059-124344081 CCACAAGGGCAGAGCCCTCATGG + Intronic
937675908 2:124589967-124589989 TCAGGAAGTCAGAGCACTCATGG - Intronic
938079596 2:128362716-128362738 TCAGGAAGGCCCAGCCCTCAGGG - Intergenic
938303706 2:130234399-130234421 TCTAGAAGGCAGACCCATCAGGG + Intergenic
938452972 2:131439868-131439890 TCTAGAAGGCAGACCCATCAGGG - Intergenic
938927538 2:136057982-136058004 TCAGGAGGGCAGAGCCCTCATGG + Intergenic
939288501 2:140163814-140163836 TCATGAAGGCAGAACCCTCATGG + Intergenic
940174422 2:150863034-150863056 TCATGAGGGAGGAGCCTTCATGG + Intergenic
940371713 2:152909399-152909421 TCACGAGGGCAGATCCTGCATGG + Intergenic
940521632 2:154757868-154757890 TCATGAGGGTAGAGCCCTCATGG + Intronic
940682772 2:156807177-156807199 TCATGAGGGCAGAGCCCTTATGG - Intergenic
940953205 2:159700033-159700055 TCATAAGGGCAGAGCCTTCATGG - Intergenic
941006320 2:160250903-160250925 TCACGAGGGTAGAGCCCTCATGG - Intronic
942750615 2:179282794-179282816 TCATGAAGGCAGAGCCCTCATGG - Intergenic
942914122 2:181282146-181282168 TCATGGGGGCAGATCCTTCATGG - Intergenic
942999479 2:182307309-182307331 TCATGAAGGCAGAGCTCTCCTGG - Intronic
943539361 2:189192825-189192847 TCACAAGGGCAGAGCCTTCATGG - Intergenic
943889866 2:193272760-193272782 TCATGAAGGAAGATCCTTCATGG - Intergenic
943990250 2:194680556-194680578 TGATGAAGGCAGAGCCCTCATGG + Intergenic
944184554 2:196932568-196932590 TCATGAAGGCAGATCATTCATGG + Intergenic
944379704 2:199093638-199093660 TCATGAGAGCAGAGCCTTTACGG + Intergenic
944443635 2:199767586-199767608 TCACGAATGCAGATCCCCCATGG - Intronic
944563190 2:200962247-200962269 GCACCAAGGCAGTGCCTTGAGGG - Intronic
944783747 2:203046725-203046747 CCATGAGGGCAGAGCCTTCTTGG + Intronic
945384267 2:209178679-209178701 TCATAAGGGCATAGCCTTCATGG + Intergenic
946113246 2:217438434-217438456 TCATGAGGGTGGAGCCTTCATGG + Intronic
946221687 2:218232946-218232968 TCATGAGGGCAGAGCCCTCATGG + Intronic
946825447 2:223672991-223673013 TCATGGAGGCAGATCCCTCATGG - Intergenic
947004300 2:225492828-225492850 TCACAGAGGCAGATCCCTCATGG - Intronic
947036461 2:225863728-225863750 TCAGGAGGGAAGAACCTTCATGG - Intergenic
947197541 2:227583879-227583901 TCATGAGTGCAGATCCTTCATGG - Intergenic
947677669 2:231998353-231998375 TCACTATGGTTGAGCCTTCATGG + Intronic
948180741 2:235978091-235978113 TCATGAAGGCCCAGCCCTCATGG + Intronic
948248036 2:236503167-236503189 TCACGGAGGCAGCCTCTTCAGGG - Intronic
948624731 2:239261948-239261970 TCACGAAGGCAGTGCTTTCATGG - Intronic
948827750 2:240581475-240581497 TCATCAAGGCAGAACCCTCATGG - Intergenic
1169774401 20:9236655-9236677 ACACCAAGGCAGAGCTTTCCTGG + Intronic
1170220870 20:13940325-13940347 TTATGAAGGCAGAGCATTCCGGG + Intronic
1170757726 20:19219285-19219307 TCATGAAGGAACAGCCTACAAGG - Intronic
1170975571 20:21160765-21160787 TCAAGGGGGCAGAGCCTTCATGG + Intronic
1171336049 20:24386506-24386528 TCATGAGGGCAGAGTCCTCATGG - Intergenic
1172308139 20:33896405-33896427 CCACGCAGGCAGAGCCCTCATGG - Intergenic
1173017272 20:39237028-39237050 TCATGCAGGCAGATCCCTCATGG + Intergenic
1173563330 20:44021702-44021724 TCAGGAAGGTAGAGGCTGCAGGG - Intronic
1174214947 20:48909232-48909254 TCATGAGGTCAGACCCTTCATGG - Intergenic
1175702543 20:61150682-61150704 TCATGAGGGTAGAGCCCTCATGG - Intergenic
1175874656 20:62223680-62223702 CCATGAAGGCAGAGCCGGCATGG + Intergenic
1177127369 21:17212238-17212260 TCATGAAAGCAGAGTCATCATGG + Intergenic
1177565650 21:22818075-22818097 TCATGGAGGCACAGCCTGCATGG - Intergenic
1178036287 21:28586877-28586899 TCATAAGGGCAGAGCCCTCATGG - Intergenic
1179139302 21:38710135-38710157 TCATGAAGGTGGAGCCGTCATGG - Intergenic
1179319231 21:40273869-40273891 TCACAAAGGGGGAGCCCTCAGGG - Intronic
1179433306 21:41340508-41340530 TCAGGAGGGCAGAGTCCTCATGG + Intronic
1179792608 21:43764324-43764346 TCACAATGGCTGAGGCTTCAGGG - Intergenic
1180787421 22:18554656-18554678 TCCCTAGGACAGAGCCTTCAGGG + Intergenic
1181234319 22:21440649-21440671 TCCCTAGGACAGAGCCTTCAGGG - Intronic
1181244329 22:21494182-21494204 TCCCTAGGACAGAGCCTTCAGGG + Intergenic
1181488254 22:23245126-23245148 TCAAGCAGGCAGAGCTGTCAGGG + Intronic
1181872386 22:25910378-25910400 CCATGAAGGTAGAGCTTTCATGG - Intronic
1183022184 22:35036227-35036249 TCATGAAGGCAGAAGCCTCATGG + Intergenic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
1183791797 22:40077276-40077298 GCAGAAAGCCAGAGCCTTCAAGG + Intronic
1184811892 22:46841210-46841232 TCATGAAGGTGGAGCCCTCATGG + Intronic
949232850 3:1772010-1772032 TTATGAGGGCAGAGCCCTCATGG + Intergenic
949772826 3:7597309-7597331 TCACAGAGGCAGATCCCTCATGG - Intronic
950500799 3:13362293-13362315 TCATGAGGGCAGAAGCTTCACGG - Intronic
951232939 3:20200577-20200599 TCAGGAAGGCAGGACCTTCTGGG + Intergenic
951562776 3:23984793-23984815 TCAAAGAGGCAGAGCCTTCATGG - Intergenic
951626300 3:24667567-24667589 TCATGAGGGCAGAGCCTTTGTGG + Intergenic
952239621 3:31516978-31517000 CCACGAAGGAAGAGCCTGCCTGG + Intergenic
952810715 3:37400118-37400140 TCATGAAGTCAGAGTCATCATGG + Intronic
953000620 3:38929724-38929746 TCACAAAGGAAGTGTCTTCATGG - Intronic
953206985 3:40839808-40839830 TCATGAGGGTGGAGCCTTCATGG + Intergenic
953741899 3:45545549-45545571 TTACCAAGGCAGTCCCTTCAGGG - Intronic
953746702 3:45579890-45579912 TCATGAGGACAGAACCTTCATGG - Intronic
953920184 3:46946445-46946467 TAAAGAAGGCAGAGCATTCCTGG + Intronic
954919743 3:54179697-54179719 TCAGAAAGGTGGAGCCTTCATGG + Intronic
955091866 3:55760348-55760370 TCACGGAGGTAGGGTCTTCAAGG - Intronic
955504892 3:59622093-59622115 TAATGAAAGCAGAGCCCTCATGG - Intergenic
956881797 3:73518803-73518825 TCATGAAGGCAGAGGTGTCATGG + Intronic
957167184 3:76690357-76690379 TCATGAGAGCAGAGCCCTCATGG + Intronic
957372991 3:79320282-79320304 TCACGAAGGTGGAGTCCTCATGG - Intronic
957429447 3:80083200-80083222 TCACGAGGGCAGAGACCTCATGG + Intergenic
960142724 3:114166419-114166441 TCATGAGGGCAGAGTCCTCAAGG - Intronic
960345263 3:116522551-116522573 TCATGGGGGCAGATCCTTCATGG + Intronic
960538161 3:118835597-118835619 TCATAAAGGCAGAGCTCTCATGG + Intergenic
962447789 3:135483643-135483665 GCACCAAGGCAGAGTATTCAAGG - Intergenic
962940818 3:140123278-140123300 TCATGAAGGCAGAGCCCTCATGG + Intronic
963122087 3:141784830-141784852 TCACAGCGGCAGAGCCCTCATGG - Intronic
963210263 3:142681666-142681688 TCAGGAAGGCTGGGCATTCAGGG + Intronic
964009865 3:151879410-151879432 TCATGAAGGTAGAGTCTTCATGG - Intronic
964094006 3:152910503-152910525 TCCAGAAGGCAGAGCTGTCATGG + Intergenic
964441580 3:156716961-156716983 TTAGGAAGGCTGTGCCTTCATGG + Intergenic
964655943 3:159066273-159066295 TCATGAGGGCAGAGCCTTCATGG - Intronic
966216216 3:177505741-177505763 TCATGAGGGCAAAGCCATCATGG - Intergenic
966338991 3:178903731-178903753 TCATGAAGGCAGTGCCCTCATGG - Intergenic
966393335 3:179475843-179475865 TTATGAGGGCAGAGCCCTCATGG + Intergenic
969350509 4:6595631-6595653 TCACGAGGGCAGAGCCTTCATGG + Intronic
970274104 4:14379040-14379062 TCATGAGGGCAAAGCCCTCATGG + Intergenic
970901601 4:21165869-21165891 TGATGAAGGCAGAGCCAGCATGG - Intronic
971084002 4:23249015-23249037 TCATGAAGGTGGAGCCCTCATGG - Intergenic
972031689 4:34467666-34467688 TTATGAGGGCAGAGCCCTCATGG + Intergenic
972297114 4:37750549-37750571 TCATGAGGGGAGAGCCCTCATGG + Intergenic
972668186 4:41188444-41188466 TCACGAGGGTACAGCCCTCATGG + Intronic
972911382 4:43821799-43821821 TCATGGAAGCAGATCCTTCATGG - Intergenic
972926289 4:44013260-44013282 TCATGAGGGCAGAGCCTTCATGG - Intergenic
974099470 4:57401100-57401122 TCATAAGGGCAGAGCCCTCACGG + Intergenic
974198576 4:58610008-58610030 TCATGAAAGCAGAGCCCTCATGG + Intergenic
974441623 4:61925720-61925742 TCATGGGGGCAGAGCCGTCATGG - Intronic
975674008 4:76808999-76809021 TCATGAAGGTAGATCCTGCATGG - Intergenic
976349344 4:84043097-84043119 TCTTGAGGGCAGAGCCCTCATGG + Intergenic
976770119 4:88642705-88642727 TCATGAGGGCAAAGCCCTCATGG - Intronic
976815666 4:89146310-89146332 AGACAAAGGCAGAGCTTTCAAGG - Intergenic
976951168 4:90833291-90833313 CCATGATGGCAGATCCTTCATGG + Intronic
977423707 4:96837835-96837857 TCATGAAGGCAGAGCATGCATGG + Intergenic
977439771 4:97049846-97049868 TCATTAGGGCAGAGCCCTCATGG - Intergenic
977529239 4:98180772-98180794 TCGTGTAGGCAGAGCCCTCATGG - Intergenic
977652420 4:99485721-99485743 TCATGAAGGCAGAGCCCTCATGG - Intergenic
977775526 4:100915059-100915081 TCATGAAGGTAGAACCCTCATGG - Intergenic
978812618 4:112868505-112868527 TCCTGAGGGCAGAGCCCTCATGG + Intronic
979349862 4:119630842-119630864 TCACAAAGGCAGAGCCCTAATGG - Intergenic
980382659 4:132044692-132044714 ACAAGAAGGCAGTGCCATCACGG - Intergenic
980655850 4:135784848-135784870 TCACGAGGGAAGAGCCCTCATGG - Intergenic
981244076 4:142513742-142513764 TCATGAAGGCAAAGCCCTCCTGG - Intronic
981260376 4:142711712-142711734 TCATGAGGACAGAGCCTTTATGG + Intronic
981263635 4:142753999-142754021 TCACGAAGGTAATGCCTTCTAGG - Intronic
981393680 4:144220882-144220904 TCAAGAGGGCAGTGCCCTCATGG + Intergenic
982106496 4:152016059-152016081 TCAGGAGGGCAGAGCCCTCATGG - Intergenic
982287227 4:153748078-153748100 TCACAAGGGCAGAGCCCTTATGG + Intronic
982294908 4:153817889-153817911 TTATGAGGGTAGAGCCTTCATGG + Intergenic
983627943 4:169821893-169821915 TCATGAAGGTGGAGCCCTCATGG + Intergenic
983652010 4:170044974-170044996 TCATGAGGGCAGAGCTTTCATGG - Intergenic
983871732 4:172831762-172831784 TCATGAAGGTAGAGCTCTCAGGG + Intronic
984135468 4:175932254-175932276 TCATGATGGAAGAGCCCTCAGGG - Intronic
984222660 4:176996569-176996591 TCACGAGGGCAGATCCTTCGTGG + Intergenic
984718905 4:182952196-182952218 TCATGGTGGCAGATCCTTCATGG + Intergenic
985231155 4:187819719-187819741 TCATGAGGGCAGAGGCCTCATGG - Intergenic
986261209 5:6147979-6148001 TCATGAGGGAAGAGCCTTTATGG + Intergenic
987154594 5:15076479-15076501 TCGTGAGGGCAGAGCCTTCATGG - Intergenic
987791085 5:22569202-22569224 TGATGAAGGCAGAGCCTTATGGG + Intronic
988566214 5:32321551-32321573 TCATGATGGCAGAGCCCTCAGGG + Intergenic
989196779 5:38724108-38724130 TCATGAGGGCAGAGCCCTCAGGG - Intergenic
989458386 5:41668356-41668378 TCACAAGAGCAGAGCCCTCAGGG + Intergenic
990969075 5:61483316-61483338 TCACCAGGGCAGAGCCCTCATGG + Intronic
991007539 5:61844629-61844651 TCATGAAGGCAGAGCCCTCCTGG - Intergenic
992984052 5:82209385-82209407 TCATGAGAGAAGAGCCTTCAAGG + Intronic
992988694 5:82260646-82260668 TCAGAAAGGCAGAGTCCTCATGG - Intronic
993601019 5:89924970-89924992 TCATGAGGGTAAAGCCTTCATGG + Intergenic
994108812 5:95977353-95977375 TTAGGAGGGCAGAGCCCTCATGG - Intergenic
994285770 5:97964160-97964182 TCATGAAGGCAGAACTCTCATGG + Intergenic
995631344 5:114136205-114136227 TCATGATGGCAGAGCCCTCATGG - Intergenic
995779591 5:115761513-115761535 TCATGAGGGCAGAGCCCTCATGG + Intergenic
996360574 5:122640997-122641019 TCATGAGGGCAGGGCCCTCATGG - Intergenic
996512949 5:124337925-124337947 TTACGAGGGCAGAGCCCTCATGG + Intergenic
997427747 5:133815811-133815833 TCAAGAAGCCAGAGCTTTTAGGG - Intergenic
997904935 5:137807192-137807214 TCATGAGGGCAGAGCCCTCATGG + Intergenic
998577092 5:143328028-143328050 CCATGGAGGCAGAGCCTTCATGG - Intronic
999136593 5:149324375-149324397 TCACGAGGGTGGAGCCCTCATGG - Intronic
999136795 5:149325877-149325899 CCATGAAGGCAAAGCCCTCATGG + Intronic
999671522 5:153962829-153962851 TTACGAGGGCTGAGCCCTCATGG - Intergenic
999900475 5:156081286-156081308 TCATGAGGGCAGATCCCTCATGG - Intronic
1000013592 5:157257366-157257388 TCATAAGGGCAGAGCCCTCACGG - Intergenic
1000242429 5:159420889-159420911 TCACGAGGGTATAGACTTCATGG + Intergenic
1000442121 5:161276507-161276529 TCATGAAGGTGGGGCCTTCATGG - Intergenic
1000979573 5:167802136-167802158 TCATGAGGGCAGAGCCTTCATGG + Intronic
1001351662 5:170973897-170973919 TCATGAGGGCAGAGCTCTCATGG - Intronic
1002886983 6:1306201-1306223 TCATGAAGGCAGAGTCCTCATGG - Intergenic
1003058638 6:2844499-2844521 TCATGAGGGCAGAACCGTCATGG - Intergenic
1003163784 6:3658545-3658567 TCATGAAGGCAGAGCCCTTATGG + Intergenic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1003340367 6:5214463-5214485 TCACGAAGCAAGAGCCTTGAAGG + Intronic
1004445979 6:15698873-15698895 TCATGGAGGCAGATCCCTCATGG - Intergenic
1004756978 6:18620950-18620972 TGATGAGGGCAGAGGCTTCATGG + Intergenic
1006401779 6:33821938-33821960 TCACGAGGGCAGAGCCTTCATGG - Intergenic
1008275496 6:49539501-49539523 TCATGAAGGCAGAGCCCTCATGG - Intergenic
1008342305 6:50382344-50382366 TCAGGAAGGCAGTTACTTCATGG - Intergenic
1008479250 6:51967902-51967924 TTTCGAAGGCAGTGCCGTCATGG - Intronic
1008549168 6:52611167-52611189 TCATAAGGGCAGAGTCTTCATGG - Intergenic
1008654527 6:53598047-53598069 TGATGAAGGCAGAGCCTTCATGG + Intronic
1008933259 6:56962031-56962053 TCATGAGGGCAGAGCCCTCATGG - Intronic
1009294572 6:61930022-61930044 TCATGAAGGCAGAGCCTTCATGG + Intronic
1009619009 6:66047058-66047080 ACATGAAGGCAGAGTCCTCATGG - Intergenic
1009873322 6:69474777-69474799 TCATGGAGGCAGATCCCTCATGG + Intergenic
1010661299 6:78573347-78573369 TCATGAAGGCAGATCCCCCATGG - Intergenic
1010905005 6:81476683-81476705 TCATGAAGGCAAAGCCCTCATGG - Intergenic
1011038372 6:83002349-83002371 CCATGAGGGCAGAGCCATCATGG - Intronic
1011284456 6:85707997-85708019 TGAAGGAGGCAGAGCCCTCATGG - Intergenic
1011403253 6:86987872-86987894 TCATGAAGGAGGAGCCTTCACGG + Intronic
1012092955 6:94922311-94922333 TCAGGAAGGCCTATCCTTCATGG + Intergenic
1012104395 6:95136512-95136534 TCATGAGGGCAGATCCCTCATGG - Intergenic
1012128641 6:95462797-95462819 TCATGAGGGCAGGGCCCTCATGG - Intergenic
1012414594 6:98999495-98999517 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1013224333 6:108109240-108109262 TCATGAGGACAGAGCCCTCACGG - Intronic
1014056770 6:117025094-117025116 TCACAAGGGCAGAGTCCTCATGG - Intergenic
1014129701 6:117816826-117816848 TCACGAGGGCAGAAACTTTATGG - Intergenic
1014170232 6:118270452-118270474 TCTCTAAGGCAGAGTCTTCCAGG - Intronic
1014669519 6:124283934-124283956 TGAACAAGGCAGAGCTTTCACGG - Intronic
1015290906 6:131537599-131537621 TCATAAGGGCAGAGCCTTCAAGG + Intergenic
1016217014 6:141616874-141616896 TCATGAGGGCAGGGCCCTCAAGG + Intergenic
1017296661 6:152803996-152804018 TCCCTTAGGCAGAGTCTTCAGGG + Intergenic
1018275716 6:162128731-162128753 TCACAAGGGCAGAGCCCTCATGG + Intronic
1018510409 6:164518757-164518779 TCATGAGGGCAGATCCCTCATGG + Intergenic
1018538186 6:164846366-164846388 TCCCCAAGGCAGAGCCAACATGG - Intergenic
1019063254 6:169273586-169273608 TCACGGGGGCAGATCCTTCATGG + Intergenic
1019132231 6:169885449-169885471 TCATGAAGACAGAGCTCTCATGG + Intergenic
1020224197 7:6266991-6267013 TCATGGAGGCAGATCCCTCATGG + Intronic
1020420167 7:7994584-7994606 TCATGAAGGCAGAGCCCTCATGG + Intronic
1020565760 7:9793622-9793644 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1021529224 7:21624035-21624057 TAATGAGGGCAGAGCCCTCATGG + Intronic
1021938280 7:25653168-25653190 TCAGGAAGGTAGAGCCTAAAGGG - Intergenic
1022220247 7:28307291-28307313 TCATGAGGCTAGAGCCTTCATGG - Intronic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1022783450 7:33610591-33610613 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1023507470 7:40915238-40915260 TCACTAAGGGAAAGACTTCAGGG + Intergenic
1023677597 7:42646820-42646842 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1024083965 7:45878388-45878410 CTACAAGGGCAGAGCCTTCATGG - Intergenic
1024855595 7:53774876-53774898 TCCTGAGTGCAGAGCCTTCATGG - Intergenic
1024889689 7:54185745-54185767 TCACGAAAGCAGAGCCCTCCTGG - Intergenic
1025002631 7:55329807-55329829 TCATGAAGGCAGGTCCCTCATGG + Intergenic
1026617628 7:71920239-71920261 TTATGAAGGCACAGGCTTCAAGG + Intronic
1029054013 7:97721162-97721184 TCATGAGGCTAGAGCCTTCATGG - Intergenic
1030392673 7:108946461-108946483 TCATGAGGGCATAGCCTTCATGG + Intergenic
1030664295 7:112257460-112257482 TCATGAACTCAGAGCCTGCAAGG + Intronic
1030828253 7:114187947-114187969 CCATGAAAGCAGAGCCCTCATGG + Intronic
1030970903 7:116053549-116053571 TCATGAGGGCAGAGCCCTCTTGG + Intronic
1031549703 7:123093347-123093369 TCATGAGGGCAGAGCTGTCATGG - Intergenic
1032852343 7:135805731-135805753 TCACGAGGGCAGAGCCCTCATGG + Intergenic
1033008282 7:137591096-137591118 TCACAAAGGCAGAGCCCACAGGG + Intronic
1033092774 7:138402435-138402457 TCAGGAGGGCAGAGCCCTTATGG + Intergenic
1033818900 7:145109604-145109626 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1034157677 7:148968837-148968859 TCATGGAGGCAGATCCCTCATGG + Intergenic
1034166818 7:149031315-149031337 TCACGAGGGTAGAGCCGTTATGG + Intergenic
1034840898 7:154395215-154395237 TCAAGAAGGCAGAATGTTCACGG - Intronic
1034932879 7:155177126-155177148 CCACGAGAGCAGAGCCCTCATGG + Intergenic
1036121891 8:6027233-6027255 CCACGAAGGTGGAGCCCTCATGG + Intergenic
1036198935 8:6749961-6749983 TCACCACGGCCGAGGCTTCACGG - Intronic
1036476948 8:9102137-9102159 CCAGGTAGGCAGAGTCTTCAGGG - Intronic
1037137581 8:15481294-15481316 TGATGACGGCAGAGCCTTCATGG - Intronic
1037462277 8:19123257-19123279 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1037463916 8:19140281-19140303 TCATGAAGGGAGAGTCCTCATGG + Intergenic
1037530860 8:19772048-19772070 TCACGAGGGCAGGGCCCTCATGG + Intergenic
1038007811 8:23448463-23448485 TCATGAGGGCAGAAACTTCAGGG + Intronic
1038936643 8:32259289-32259311 TTATGAAGGCAGAGCCCTCATGG - Intronic
1039214822 8:35258256-35258278 TCATCAGGGCAGAGCCCTCATGG + Intronic
1040081820 8:43292628-43292650 CCACGACGACAGCGCCTTCACGG + Intergenic
1040655503 8:49502918-49502940 TCATGAAGGCAGAGCCATCATGG + Intergenic
1040657395 8:49527551-49527573 TCATGAAAACAGAGCCCTCATGG + Intergenic
1040858763 8:51977426-51977448 TCCTGAGGGCAGAGCCCTCAGGG + Intergenic
1041638494 8:60171250-60171272 TCATGAAGGCAGAACCCTTATGG - Intergenic
1042586989 8:70351110-70351132 TCATGAGAGCAGAGCCCTCACGG + Intronic
1042928990 8:73995041-73995063 TCATGAGAGAAGAGCCTTCATGG - Intronic
1043310203 8:78849569-78849591 ACAGGAAGGCAGATCCCTCATGG - Intergenic
1044544892 8:93448694-93448716 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1044561055 8:93612692-93612714 TCCTGAAGGCAGGGCCCTCATGG + Intergenic
1044825205 8:96189442-96189464 TCACCAGGACAGAGCCCTCATGG - Intergenic
1044928600 8:97230624-97230646 TCACAAAGACAGAGCTTTCATGG - Intergenic
1045554307 8:103200813-103200835 TCATGAAGACAGAACCGTCATGG + Intronic
1045655846 8:104385692-104385714 TCATAAAGGCAGAGCCCTCATGG - Intronic
1045817598 8:106294694-106294716 TCATGGAGGCAGATCCTTCATGG - Intronic
1045930499 8:107620350-107620372 TCACGGAGGCAGATTCCTCAAGG + Intergenic
1046418666 8:113949069-113949091 TTAGGAGGGCAGAGCCCTCATGG - Intergenic
1047028544 8:120851136-120851158 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1047438100 8:124852047-124852069 TCACGAGGGCACACCCCTCATGG + Intergenic
1048190091 8:132280527-132280549 TCATGGAGGCAGATCCGTCATGG - Intronic
1048470727 8:134701939-134701961 TCATGAGAGCAGAGCCATCATGG - Intronic
1050583095 9:7081657-7081679 TCACGAGCCCAGAGCCTACAGGG + Intergenic
1050706013 9:8398607-8398629 TCATCAGGGCAGAGCCCTCATGG + Intronic
1050769282 9:9176611-9176633 TCATGAGGGCAGAGGCCTCATGG - Intronic
1051194171 9:14545349-14545371 TCACGAACACAGATCCTTCATGG + Intergenic
1051882989 9:21859100-21859122 TCATGAAGGCAGAGTCCTCGTGG - Intronic
1052143301 9:25016354-25016376 TCATGAAGGCAGAGCCTTCATGG + Intergenic
1052871780 9:33514581-33514603 TCTAGAAGGCATAGCCTGCAAGG - Intergenic
1052940191 9:34126658-34126680 TTCCGACGGCAGAGCCTGCAAGG + Exonic
1053183929 9:35998377-35998399 TCATGAAGGCTGAGCCCTCTTGG - Intergenic
1053459665 9:38258522-38258544 TCATGAGGGCAGAGCCCTCACGG + Intergenic
1054148610 9:61582729-61582751 TCAGGGAGGCAGCGCCTTAAAGG + Intergenic
1054854050 9:69879032-69879054 TCATGGAGGCAGATCCCTCATGG - Intronic
1055019157 9:71650321-71650343 TCATGAGGGCAGAGCCCTGATGG - Intergenic
1055528970 9:77164354-77164376 TCATGAAGGTGGAGCCTTCATGG + Intergenic
1056469942 9:86895492-86895514 TCACGAGGGAGGAGCCCTCATGG - Intergenic
1056761113 9:89415533-89415555 TCAGGAGGGCAGAGTCTTCATGG + Intronic
1056955435 9:91077311-91077333 TCATGAAAGCAGAGTCCTCATGG + Intergenic
1057282966 9:93726150-93726172 AGAGAAAGGCAGAGCCTTCAGGG - Intergenic
1057318792 9:93992538-93992560 TCATGAAGGCAGAGCCTCATGGG + Intergenic
1057673293 9:97114816-97114838 TCACGAGGGTGGAGCCCTCATGG + Intergenic
1057970635 9:99554132-99554154 TCATGAGGGTAGAGCCCTCATGG + Intergenic
1057986136 9:99715853-99715875 TCATGAGGGCAGAGCACTCATGG - Intergenic
1058114055 9:101064942-101064964 TCTCAAAGGCAGAGCCCTCATGG - Intronic
1058129460 9:101233567-101233589 CCATGAAGGTGGAGCCTTCATGG - Intronic
1058238792 9:102529078-102529100 TTATGAGGGCAGAGCCCTCACGG + Intergenic
1059012542 9:110477675-110477697 TCAAGGAGGCAGAGCATACAAGG - Intronic
1059081566 9:111255674-111255696 TCATGAGGGCAGAGTCTTCATGG + Intergenic
1059263443 9:113002805-113002827 TCATGAGTGTAGAGCCTTCATGG + Intergenic
1059370726 9:113831402-113831424 TCATGAAGTCAGAGCACTCATGG - Intergenic
1060386760 9:123237574-123237596 TCTCGAATGCACAGCTTTCAAGG - Intronic
1060739279 9:126087635-126087657 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1060805449 9:126572945-126572967 TCGTGAGGACAGAGCCTTCATGG + Intergenic
1061534508 9:131239253-131239275 TCCCCACGGCAGAGCCTTCCTGG + Intergenic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1185516668 X:704377-704399 TCACGACAGCAGAGCCCTCATGG - Intergenic
1186179286 X:6957309-6957331 TCATAAGGGCAGAGCCTTCATGG - Intergenic
1187205370 X:17176555-17176577 TCAAGAATGAAGAGACTTCAGGG - Intergenic
1187584087 X:20640679-20640701 TCATGGAGGCAGATCCCTCATGG - Intergenic
1188049051 X:25461994-25462016 TAAAGAGGGCAGAGCCCTCATGG - Intergenic
1188332118 X:28887164-28887186 TCACACAGGAGGAGCCTTCATGG - Intronic
1188424689 X:30032691-30032713 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1188480466 X:30632028-30632050 CCATGAAGGTAGAGCCCTCATGG - Intergenic
1188508236 X:30906470-30906492 TTACAAAGGCAGAGCCCTCATGG + Intronic
1189102039 X:38200731-38200753 TCATGAAGGCAGAGCCCTAATGG + Intronic
1189554214 X:42125580-42125602 TCATGCAGGCAGATCCTTCATGG + Intergenic
1190103189 X:47538767-47538789 TCATGGGGGCAGATCCTTCATGG + Intergenic
1192295256 X:69840919-69840941 TCACAAAGGAAGAGCCTTCATGG + Intronic
1192416547 X:70986126-70986148 TCAGGAGGGCAAAGCCTTCATGG + Intergenic
1193682746 X:84541789-84541811 CCACAGAGGCAGAGCCCTCATGG + Intergenic
1194890104 X:99368179-99368201 TCATGATGGCAGAGTCCTCATGG - Intergenic
1195292572 X:103443343-103443365 TCATGAAGGCAGAACCCTCATGG - Intergenic
1195531992 X:105968173-105968195 TCATGAGGACAGAGCCCTCATGG + Intergenic
1195577051 X:106463020-106463042 TCATGAAGGAGGAGCCCTCATGG + Intergenic
1195629300 X:107037421-107037443 TCATGACGGCAAAGCCCTCATGG - Intergenic
1196221447 X:113115718-113115740 TCATGAGGGCAGAGCTCTCATGG + Intergenic
1197296474 X:124724874-124724896 TCATGAAGACAGAACCCTCATGG - Intronic
1197679463 X:129366802-129366824 TCATGGAGGCAGATCCTTCATGG - Intergenic
1198525696 X:137498282-137498304 TCATGAGGGCAGAACCCTCATGG + Intergenic
1198546428 X:137697379-137697401 TCGTGAGGGCAGAGCCCTCATGG + Intergenic
1198742732 X:139857981-139858003 TCATGAGGGCAGAGCCCTTATGG - Intronic
1198771451 X:140135106-140135128 TCATGAGGCCAGAGCCCTCATGG + Intergenic
1198780660 X:140232106-140232128 TCACAAGAGCAGAGCCCTCATGG + Intergenic
1199512578 X:148638786-148638808 TCACGGGGGCAGATCCCTCATGG - Intronic
1199898289 X:152147252-152147274 TCATGAGGGCAGAGTTTTCATGG + Intergenic
1200382967 X:155859031-155859053 TCATGAGGGCAAAGCCCTCATGG - Intergenic
1200766059 Y:7081798-7081820 TCAAGAGGGCAGATCCCTCATGG - Intronic
1200896952 Y:8385797-8385819 CCAAGGAGGCAGAGCTTTCAGGG + Intergenic