ID: 1134024646

View in Genome Browser
Species Human (GRCh38)
Location 16:10944644-10944666
Sequence GAGCGGCCCAGCGCCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134024646_1134024655 18 Left 1134024646 16:10944644-10944666 CCGCCGCGGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1134024655 16:10944685-10944707 CCGTGAGACGAGAGACGGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 52
1134024646_1134024657 20 Left 1134024646 16:10944644-10944666 CCGCCGCGGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1134024657 16:10944687-10944709 GTGAGACGAGAGACGGGTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1134024646_1134024652 13 Left 1134024646 16:10944644-10944666 CCGCCGCGGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1134024652 16:10944680-10944702 TGAGACCGTGAGACGAGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 142
1134024646_1134024653 14 Left 1134024646 16:10944644-10944666 CCGCCGCGGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1134024653 16:10944681-10944703 GAGACCGTGAGACGAGAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 154
1134024646_1134024656 19 Left 1134024646 16:10944644-10944666 CCGCCGCGGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1134024656 16:10944686-10944708 CGTGAGACGAGAGACGGGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134024646 Original CRISPR GAGCGGCCCAGCGCCCGCGG CGG (reversed) Exonic
901660107 1:10794003-10794025 GAACGGCCCAGCGCCCCCTCCGG + Intronic
901749586 1:11397593-11397615 GAGAGGCCCAGCGGCTGTGGCGG + Intergenic
902808998 1:18877722-18877744 GAGCAGCCCAGAGCGGGCGGAGG + Intronic
903350044 1:22711580-22711602 GAGCGCGCCAGCCCCCGCGTCGG + Intronic
903366180 1:22806713-22806735 GGGCGGCCCAGCGCCTGCATAGG + Intronic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
903907482 1:26696758-26696780 GAGCCGCCCGGCGGCGGCGGTGG + Exonic
904500202 1:30908789-30908811 GGGCGGCCCGGCGGCGGCGGCGG - Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
910835198 1:91501337-91501359 GAGGGGCCGAGCGCCGGGGGCGG - Intronic
910876906 1:91886265-91886287 GGGCGGCCGAGAGCCCCCGGTGG - Exonic
916496728 1:165354265-165354287 GACCGGCCCAGCTCCCGAGCCGG - Intronic
921355477 1:214281134-214281156 GAGCCGCCCGGCGGACGCGGCGG - Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
922739592 1:228007718-228007740 GAGTGGCGCAGAGCCGGCGGCGG + Intronic
924729290 1:246697141-246697163 GCGTGGCCCAGCGGCCGCAGGGG + Intergenic
1063379619 10:5576080-5576102 GGTGGGCCCAGCGCCCGCAGCGG + Intergenic
1065614328 10:27504563-27504585 GCGCGGCCCAGAGGCCGAGGAGG - Intronic
1065807668 10:29409826-29409848 GCGCGGCCCAGAGGCCGAGGAGG - Intergenic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067561929 10:47310331-47310353 GCGCGGCTCGGCGCACGCGGGGG - Exonic
1070055044 10:72926164-72926186 GAGCAGCTCAGCACCCTCGGGGG + Intronic
1073060251 10:100729646-100729668 CCGCGACCCAGCGCCAGCGGAGG - Intergenic
1076356122 10:129855029-129855051 GAGCTCCCCAGTGCCAGCGGGGG + Intronic
1076358188 10:129867954-129867976 GAGCGGCCCAGCGTCGGAGGAGG - Intronic
1077360795 11:2139432-2139454 CCGCGGCCCAGGGCCCGCGCGGG + Intronic
1078659861 11:13277988-13278010 CAGGGGCGCAGCGCCCGCGAGGG - Intronic
1080385816 11:31810598-31810620 GAGCGGCGCAGGGCTCGGGGCGG - Intronic
1084000187 11:66291900-66291922 GCTCGGCTCAGCGGCCGCGGAGG - Exonic
1084003940 11:66313532-66313554 GAGTGGCCCAGCGCCCCCTTCGG - Intergenic
1084636768 11:70398322-70398344 GAGCAGCACACAGCCCGCGGCGG - Intergenic
1087014626 11:93543244-93543266 GAGCGGCGCGGCGGCGGCGGCGG - Intronic
1088286844 11:108198966-108198988 TAGCTGCCCAGTGCCAGCGGAGG - Intronic
1091286570 11:134411768-134411790 GCGCGGCGGGGCGCCCGCGGGGG + Intronic
1091915512 12:4269898-4269920 CAGCGGCCCAGCGCCCCGGCGGG + Intergenic
1094238017 12:28190599-28190621 GAGCGGCGCAGCGGCGGCAGCGG + Exonic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1098161199 12:67649218-67649240 GGGCTGCCCAGGGCCGGCGGGGG - Intronic
1098943065 12:76559552-76559574 GCGCTGCCCAGCGGCCGCGGAGG + Exonic
1099202077 12:79689924-79689946 GGGCGGCCCCCGGCCCGCGGCGG - Exonic
1101302493 12:103495945-103495967 GAGTGCTCCAGCTCCCGCGGAGG - Exonic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1105557362 13:21459415-21459437 GGGCGGCCCGCGGCCCGCGGCGG - Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1107467791 13:40665778-40665800 GAGCGGCCCAGCGGCGGCGGGGG + Exonic
1110119467 13:71865340-71865362 GAGCGGACCAGCACCCGAGGAGG - Intronic
1113200991 13:107867324-107867346 GGGCGGCCCTGCGGCAGCGGCGG - Intergenic
1113480408 13:110616006-110616028 GAGCGGCGGAGCCCGCGCGGTGG + Intronic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1123019641 14:105391649-105391671 GAGCGTGCCAGAGCCCGAGGGGG - Exonic
1123021067 14:105398256-105398278 CTGCGGCCCCGCGCGCGCGGAGG + Intergenic
1128374576 15:67065949-67065971 GCGCGGCCCTGCGCCCGGAGCGG - Exonic
1128635473 15:69299535-69299557 GGGCGGCCCACTGCCTGCGGGGG + Intronic
1129644812 15:77420140-77420162 GAGCGGCCGGGAGCGCGCGGTGG - Exonic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132275295 15:100558775-100558797 GAACGTCCCAGTGCCCACGGTGG + Intergenic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1132641759 16:981454-981476 GAGCCGCGCGGCGCCCGCAGAGG + Intergenic
1132871272 16:2116763-2116785 GGCCTGCCGAGCGCCCGCGGTGG - Intronic
1133033831 16:3023882-3023904 GAGGGGCCCAGCGCCTCCCGCGG - Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134521254 16:14920131-14920153 GGCCTGCCGAGCGCCCGCGGTGG + Intronic
1134708929 16:16318782-16318804 GGCCTGCCGAGCGCCCGCGGTGG + Intergenic
1134716139 16:16358816-16358838 GGCCTGCCGAGCGCCCGCGGTGG + Intergenic
1134950676 16:18349863-18349885 GGCCTGCCGAGCGCCCGCGGTGG - Intergenic
1134958614 16:18393343-18393365 GGCCTGCCGAGCGCCCGCGGTGG - Intergenic
1136271903 16:29153541-29153563 GAAGGGCCCAGAGCCCCCGGAGG - Intergenic
1136458297 16:30394964-30394986 GAGAGGCCGAGGGCCCGGGGTGG - Intronic
1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG + Intronic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1141025320 16:80541172-80541194 GGGCGGTCCAGGGGCCGCGGCGG + Intronic
1141608659 16:85169477-85169499 GGGCGGCCCGGGGCGCGCGGGGG + Intergenic
1141720118 16:85751225-85751247 GACCCGCCCGGCGCCCTCGGCGG + Intergenic
1143150882 17:4807196-4807218 GACGGAGCCAGCGCCCGCGGGGG - Exonic
1146058612 17:29593265-29593287 GTGCGCCCCCGCGCCCGCTGCGG + Intronic
1147307405 17:39573637-39573659 GCGCGGCCCGGCGGCGGCGGCGG - Intergenic
1148156841 17:45429597-45429619 CCGCGCCCCAGCGCCCGGGGAGG + Intronic
1151780290 17:76240718-76240740 GCGCGGCCGGGTGCCCGCGGCGG + Intergenic
1152111563 17:78359985-78360007 GCCCGGCCCAGCTCCCGCCGCGG - Exonic
1152516139 17:80826011-80826033 GAGCTCCCCAGGGCCGGCGGAGG - Intronic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1153040973 18:812478-812500 AAGCGGCCCGGAGCCCGCGGAGG - Exonic
1153935104 18:9914219-9914241 GAGCGGGGGCGCGCCCGCGGCGG - Exonic
1154241467 18:12657608-12657630 GCGCGGCCGAGCGCACACGGTGG + Exonic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1161065775 19:2236560-2236582 GAGCGGCCAGGCGCAGGCGGAGG + Exonic
1162022058 19:7872546-7872568 AGGCGGCCCAGCGCCGGTGGGGG - Exonic
1162398359 19:10430804-10430826 CAGCTCCCCAGCGCCCGCCGAGG + Intronic
1162817823 19:13207229-13207251 GAGCCGCGCAGAGGCCGCGGGGG - Exonic
1162909765 19:13842585-13842607 GAGCGCCCCGCCGCCCGGGGTGG - Intergenic
1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG + Intronic
1163793372 19:19321205-19321227 GAGCGGCCCCCCACCCGCCGCGG - Intronic
1165129173 19:33621700-33621722 GCGCGGTCCGGCGGCCGCGGGGG - Intergenic
1165327787 19:35124408-35124430 GAGCGGCCCAGGTCCCAGGGAGG - Intergenic
1165774360 19:38395998-38396020 GCGCGGCCCAGCGCGCGGCGGGG - Exonic
1166358699 19:42242591-42242613 CTCCGGCCCAGCGCCCGCCGCGG + Exonic
1166796403 19:45428811-45428833 GCGCGGCCCGGCGATCGCGGCGG + Intronic
1166876964 19:45903123-45903145 GAGCGGCCCAGCGCAGGGGCGGG - Intergenic
1166983960 19:46648976-46648998 CCGCGGCCCAGCGCCCACGCTGG - Exonic
1167649049 19:50719634-50719656 GAGGGGCGCGGCGGCCGCGGCGG - Intergenic
1168272127 19:55255718-55255740 GAGCAGCCCAGCCCCGGCTGAGG - Intronic
1168288793 19:55347197-55347219 GAGGGGCCCAGCGGGCGTGGGGG - Exonic
925146090 2:1584392-1584414 CAGCAGGGCAGCGCCCGCGGTGG - Intergenic
927472503 2:23386163-23386185 GAGCGGCCCAGGGCCCCGGCCGG + Intronic
927811761 2:26184415-26184437 CGGCGGCCCAGCGAGCGCGGGGG + Exonic
928022515 2:27715759-27715781 GAGGGGCCCAGAGGCCGGGGCGG + Intergenic
931429211 2:62196073-62196095 GCGGGGCCGGGCGCCCGCGGCGG + Intergenic
934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG + Intronic
937182957 2:120012835-120012857 CTGCGGCCCTCCGCCCGCGGAGG - Intergenic
938265225 2:129923426-129923448 GAGGGTCCCAGCGCCCCCTGGGG - Intergenic
938547970 2:132352656-132352678 CAAAGGCCCAGCGCCCGCGCAGG + Intergenic
940971865 2:159904393-159904415 AAGCGCCCCAGTGCCCTCGGGGG - Intronic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
946431017 2:219627520-219627542 GTGCGGCCCGGCGGCGGCGGCGG + Intronic
948823154 2:240560511-240560533 TCCCGGCCCAGCGCCCGCGGGGG + Exonic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1169978112 20:11353346-11353368 GGGCGGCCCAGCTCCGGGGGAGG + Intergenic
1171013635 20:21521962-21521984 GAGGGGCGCGGCACCCGCGGCGG - Intergenic
1175036562 20:56005511-56005533 GGGCGGACCAGAGCCCGTGGGGG + Intergenic
1175448540 20:59043001-59043023 GCGCAGCACAGCGCCCGCGCCGG - Intergenic
1176062597 20:63178888-63178910 GAGCGCCCAGGCGCCCGCAGAGG + Intergenic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1183606105 22:38867478-38867500 GAGTGGCCCAGGGCCCTCTGTGG - Intronic
1184640770 22:45868804-45868826 GAGCACCTCAGCGGCCGCGGCGG - Intergenic
1184674275 22:46032072-46032094 CAGCGGCCCAGCCCCGGGGGAGG + Intergenic
1185179280 22:49349939-49349961 GAGAGGCCCAGGGCAGGCGGGGG - Intergenic
954994835 3:54871864-54871886 GAGGGGACCAGCGTCCGCAGGGG - Intronic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
968583302 4:1404737-1404759 GAGCTGCCCAGCGGCAGCCGCGG + Intronic
981128329 4:141132300-141132322 GAGTGGCCCAGCGGGCGCGGGGG - Intronic
984759647 4:183352570-183352592 GAGTGCCCCAGAGCCCGCAGAGG - Intergenic
985064304 4:186105472-186105494 GCGCGGCCCAGACCCCGCCGGGG - Intronic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
985605576 5:855965-855987 GAGGGGCACAGACCCCGCGGAGG + Intronic
985784571 5:1887061-1887083 GAGCGGCCCAGCGCCACCGCAGG - Exonic
986421850 5:7593104-7593126 CAGCTGCCCAGCGCCCTCTGGGG + Intronic
996056475 5:118988391-118988413 GGGCGGCGCAGTGCCGGCGGCGG - Exonic
997297431 5:132776949-132776971 GCGCGGCCGAGAGCCCGCGCCGG + Intronic
997470646 5:134115182-134115204 GCGCGGCGCGGCGACCGCGGGGG - Intronic
997727422 5:136133141-136133163 GTGCGGCCCAGCGGCTGCGGAGG + Intronic
1002788870 6:424262-424284 GAGCTCAGCAGCGCCCGCGGCGG - Intergenic
1006671501 6:35732143-35732165 GAGGGGGCCAGCGCCCCCAGAGG - Intergenic
1010141919 6:72622246-72622268 GAGCGGCGCAGCGGCGGCGGCGG + Exonic
1012137543 6:95577705-95577727 GAGCGCGCAGGCGCCCGCGGTGG - Intronic
1013538826 6:111087809-111087831 GCTCGGCCCCGCGCCCACGGGGG + Exonic
1016738921 6:147508448-147508470 GAGCGCGCCAGCGGCGGCGGCGG + Intergenic
1016739151 6:147509405-147509427 GGGCGGCCCGGGGCGCGCGGCGG + Intronic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1019604139 7:1900066-1900088 CAGCGGCCCTGCGCTCTCGGCGG - Intronic
1024578302 7:50782386-50782408 CCACCGCCCAGCGCCCGCGGCGG + Intronic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1029896659 7:103990236-103990258 GAGGGGCCGGGCGGCCGCGGCGG - Intergenic
1032525387 7:132575882-132575904 TGGTGGCCCAGCGCCCGGGGAGG - Intronic
1034306623 7:150048921-150048943 GCGGGGCGCAGCGCCCGCGAGGG - Intergenic
1034440001 7:151081524-151081546 ACGCTGCCAAGCGCCCGCGGAGG + Exonic
1034680691 7:152925480-152925502 GAGGGGCCGGGCGCGCGCGGGGG + Intergenic
1035179387 7:157078211-157078233 GAGAGGCCCAGCCCACGCTGAGG + Intergenic
1035212358 7:157337410-157337432 ACGCGGCCCAGCCTCCGCGGCGG + Intronic
1035283486 7:157792257-157792279 GAGAGGCCAGGCGCCCGCAGCGG + Intronic
1036964054 8:13276564-13276586 CCGCGGCCAAGCGCGCGCGGCGG + Intronic
1037826800 8:22164858-22164880 GCTCGGCCGCGCGCCCGCGGGGG + Exonic
1038319744 8:26515061-26515083 GAGCGGCTCAGAGCGTGCGGTGG + Intronic
1039608718 8:38902281-38902303 GAGGGGCGCAGGGCCCGCTGCGG + Intronic
1040676531 8:49757317-49757339 GAGAGGCCCAGGGCCAGAGGTGG - Intergenic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1049798362 8:144506630-144506652 GCGCGCTCCACCGCCCGCGGGGG - Exonic
1051170652 9:14315599-14315621 GAGCCGCTCGGCGCCCGCGCCGG + Intronic
1057304325 9:93903564-93903586 GAGGGGCCCAGCTCCTGCTGTGG - Intergenic
1057772681 9:97982859-97982881 GGGCGGCCCGACGCCCGCGGAGG - Intergenic
1059102539 9:111484065-111484087 GACTGGCCCTGCGCGCGCGGCGG - Exonic
1061666626 9:132163675-132163697 CAGGGGCCCCGCGCCCGCCGCGG + Intronic
1062488050 9:136791030-136791052 GAGCGGGCCTGCGCAGGCGGAGG - Intergenic
1062572293 9:137191261-137191283 GAGGGGCCCAGAGCCTGGGGAGG - Intergenic
1062685255 9:137809407-137809429 CGGCGGCCCTGCGCCCTCGGAGG + Intronic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1187281459 X:17860974-17860996 GCGGGGCCCGGCGCCCGGGGAGG - Intronic
1192260980 X:69505659-69505681 GACCGGCCGAGAGCCGGCGGCGG - Exonic
1199500573 X:148501529-148501551 CAGGTGCCCAACGCCCGCGGCGG + Intronic