ID: 1134024801

View in Genome Browser
Species Human (GRCh38)
Location 16:10945456-10945478
Sequence GGGAATGACTCTACAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134024793_1134024801 30 Left 1134024793 16:10945403-10945425 CCAGGATTTTGGGGCGATTGGGG 0: 1
1: 0
2: 2
3: 6
4: 92
Right 1134024801 16:10945456-10945478 GGGAATGACTCTACAGCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134024801 Original CRISPR GGGAATGACTCTACAGCTCT GGG Intronic
900958237 1:5901758-5901780 GGGAATGAGTCTTCAGCAGTGGG + Intronic
901674251 1:10873669-10873691 GTGATTGACTCTGCAGCCCTGGG - Intergenic
902171146 1:14612316-14612338 GGCAAGGGCTCTACAGCTCAGGG - Intronic
902661540 1:17907617-17907639 TGGAATGACTATACAGATTTTGG - Intergenic
906988103 1:50708579-50708601 GGTACTGACTCTCCTGCTCTGGG - Intronic
907558163 1:55363482-55363504 GGAAATGACTCTCCAGTTCTTGG + Intergenic
912728303 1:112078394-112078416 GGAAATTACTCTACCTCTCTGGG + Intergenic
913528828 1:119718559-119718581 GGCAATGACTTTCCAGTTCTTGG + Intronic
914250512 1:145918284-145918306 GGGAGTGCCTCCTCAGCTCTGGG + Intronic
915383755 1:155470099-155470121 GGGACTGACTTTAAAGGTCTTGG - Intronic
916085788 1:161268175-161268197 GAGAATGGCTCTAAACCTCTGGG - Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918448458 1:184636550-184636572 TGGAATGTATCTACAGCTCCAGG - Intergenic
918795360 1:188887859-188887881 GGTGGTGACACTACAGCTCTGGG - Intergenic
918832886 1:189421188-189421210 GGGAAAAGCTCTAAAGCTCTTGG + Intergenic
921375774 1:214471948-214471970 GGCCATGTCTCTACAGCTCCTGG + Intronic
923405474 1:233655004-233655026 GTCTATGACTCTACAGGTCTGGG - Intronic
1066635863 10:37499379-37499401 GGGATAGATTCTAAAGCTCTAGG - Intergenic
1071325558 10:84513099-84513121 CAGAATGATTCTACAGCTTTTGG - Intronic
1071415722 10:85439442-85439464 TGGAATGACTGTTCTGCTCTGGG + Intergenic
1072466420 10:95666683-95666705 GGGAATGATTTTTCAGCTATGGG + Intronic
1072601413 10:96934415-96934437 GCTTATGACTCTATAGCTCTAGG - Intronic
1076803073 10:132841495-132841517 GCCAGTGACTCCACAGCTCTGGG + Intronic
1079015304 11:16863648-16863670 ACGAATGCCTCTGCAGCTCTCGG - Intronic
1080257191 11:30303851-30303873 GTGAATTGCTCTACAACTCTAGG - Intergenic
1087721615 11:101672120-101672142 GGGAATCATTCAACAGCACTTGG - Intronic
1088573919 11:111251289-111251311 TAGAATGACTCTACAGCTTCAGG + Intergenic
1089145625 11:116327914-116327936 GGGAATGAGGCTACAGCACCTGG - Intergenic
1089838558 11:121393561-121393583 GTGAATGGCTCTAAAGCCCTAGG - Intergenic
1091343598 11:134838250-134838272 GGGCATGAAGCTGCAGCTCTCGG + Intergenic
1091509438 12:1107256-1107278 AAGAATGACTGTACTGCTCTAGG + Intronic
1092873287 12:12826301-12826323 GGCAATTGCTCTCCAGCTCTAGG - Intronic
1096253897 12:50051322-50051344 GGGACTGGCTCTCTAGCTCTGGG - Intergenic
1098094573 12:66941262-66941284 GGAAATGAATCTACAGATTTGGG - Intergenic
1103726469 12:122999713-122999735 GGGGATGCCTCTACAGCTGCAGG - Intronic
1105442483 13:20427009-20427031 GGGAATGAATCTGCAACCCTCGG - Intronic
1106094369 13:26629643-26629665 GGGAGGGGCACTACAGCTCTTGG + Intronic
1106928351 13:34636449-34636471 GGGAAGGAGGCTACAGGTCTAGG - Intergenic
1109198219 13:59402526-59402548 GGGAATGTCTCTACTTCTCCGGG + Intergenic
1111521854 13:89415065-89415087 GAGAATGACACTGCAGCTCCTGG + Intergenic
1112887164 13:104188410-104188432 GGGGATGCCTCTACAACTCAAGG + Intergenic
1113124453 13:106961314-106961336 GTGAATGACTGCACAGCTCTGGG + Intergenic
1114353956 14:21886932-21886954 GGGAAAGCCTATAAAGCTCTAGG + Intergenic
1122545286 14:102518331-102518353 TGGGATCACTCTACAGCTGTAGG + Intergenic
1126457808 15:48883348-48883370 GCAAATGACTCTACTACTCTGGG - Intronic
1128754496 15:70172222-70172244 GGGAATGAGTCTCCAGAACTTGG + Intergenic
1129640623 15:77373425-77373447 GGCAATGACTGAACACCTCTTGG + Intronic
1132643919 16:990167-990189 GGGAATGACCCTGGAGTTCTGGG + Intergenic
1134024801 16:10945456-10945478 GGGAATGACTCTACAGCTCTGGG + Intronic
1136373550 16:29850909-29850931 GGAAATGAGTCCAGAGCTCTTGG - Intergenic
1139704999 16:68735222-68735244 GGGAATAATAATACAGCTCTTGG + Intergenic
1140511763 16:75513633-75513655 AGGAATGAGCCAACAGCTCTTGG - Intergenic
1142379602 16:89723781-89723803 GTGAATGTCTCCACTGCTCTAGG + Intronic
1144210985 17:13015282-13015304 GGGAAAGACTTAACAGGTCTTGG + Intronic
1151409165 17:73909782-73909804 GTGGAAGACTCTACAGCTATAGG + Intergenic
1154253064 18:12760337-12760359 GGCCATGACTTTACATCTCTAGG - Intergenic
1166049193 19:40248025-40248047 GGCAATGACCCCACAGCTCCTGG - Intronic
925122173 2:1427765-1427787 GGGAATGAATTTACTGCTCAAGG - Intronic
926825139 2:16898735-16898757 GGCAATGAGTCTACTCCTCTGGG + Intergenic
926967929 2:18436532-18436554 AGGAAGGATTCTTCAGCTCTGGG + Intergenic
932623139 2:73278236-73278258 GGTGAGGACTTTACAGCTCTTGG - Intronic
934173116 2:89556362-89556384 GTGGATGCCTGTACAGCTCTAGG + Intergenic
934283431 2:91630719-91630741 GTGGATGCCTGTACAGCTCTAGG + Intergenic
936748477 2:115610620-115610642 GTGAATGAAACTACAGGTCTGGG + Intronic
936848181 2:116863277-116863299 GGGAATGCATTTACAGCTCATGG + Intergenic
938278923 2:130051210-130051232 GGGAATGACACACCATCTCTGGG - Intergenic
938436447 2:131286139-131286161 GGGAATGACACACCATCTCTGGG + Intronic
942972915 2:181978771-181978793 GGGAATTAGACTACAACTCTTGG + Intronic
946598908 2:221338000-221338022 GGGAAACACCCTACATCTCTAGG + Intergenic
948512098 2:238475350-238475372 GGGATTGCTTCTACAGCCCTAGG + Intergenic
948674096 2:239587135-239587157 GGGAAAGTCTCGGCAGCTCTTGG - Intergenic
1168922635 20:1553122-1553144 GGGAATGACTCAACCCCTATGGG + Intronic
1172152694 20:32801516-32801538 GGGAATGACTTTCCCGTTCTTGG + Intronic
1172701290 20:36855127-36855149 GGGAAGGACCCGACAGCACTTGG - Intronic
1173297068 20:41769191-41769213 GAGAATGATTCTAAAGCACTTGG + Intergenic
1173995024 20:47331390-47331412 GGGAATGAGTCCATATCTCTGGG + Intronic
1176717150 21:10362365-10362387 GGGAAAGTCTCTCCAGGTCTTGG - Intergenic
1177887041 21:26759868-26759890 GTTAATGATTCTAAAGCTCTGGG - Intergenic
1179632632 21:42688279-42688301 GGGCCTGGCTCTGCAGCTCTTGG - Intronic
1180601186 22:17017610-17017632 GGGAAAGTCTCTCCAGGTCTTGG + Intergenic
1181983070 22:26780006-26780028 GGGAATGTCTCAGCAGCTATTGG - Intergenic
1183417592 22:37691424-37691446 GGTAATGACTGCACAGCTCAAGG + Exonic
1185340874 22:50290566-50290588 GGCAATGGCACTGCAGCTCTGGG - Exonic
950090691 3:10292125-10292147 TGGAAAGACTTTAAAGCTCTGGG + Intronic
950760147 3:15215409-15215431 GGGGATGACTGCACAACTCTGGG - Intronic
950915230 3:16637793-16637815 GGGAAGGAATCATCAGCTCTGGG + Intronic
953572159 3:44079656-44079678 GAGAATGTCTCCAAAGCTCTGGG - Intergenic
954670988 3:52291287-52291309 GGGGAGGACTCCACAGCTCAGGG - Intronic
959813833 3:110652302-110652324 GGGAATGAAACTCCAGCCCTGGG + Intergenic
963062238 3:141234398-141234420 GGGACTGGGGCTACAGCTCTGGG - Intronic
966541487 3:181095783-181095805 CTTAAGGACTCTACAGCTCTGGG + Intergenic
966758784 3:183396175-183396197 GGGAAATACTCCACAGCTCTTGG + Intronic
969087957 4:4670461-4670483 GGGAAGGAATCCTCAGCTCTGGG + Intergenic
971842618 4:31873637-31873659 GGGAATGACTAGAGATCTCTAGG - Intergenic
977334303 4:95676860-95676882 GGGAATAAGTCTTGAGCTCTCGG - Intergenic
978474213 4:109107711-109107733 TAGAATGACTCTACAGATGTCGG - Intronic
978848946 4:113310001-113310023 TGGAATGACTCTACATCTGAAGG - Intronic
987494493 5:18626401-18626423 GGGATAGATTCTAAAGCTCTAGG + Intergenic
988592804 5:32563636-32563658 CGAAAGGACTATACAGCTCTGGG + Intronic
990884646 5:60577379-60577401 GGGAATGACTCAACAGTTGGGGG - Intergenic
993215029 5:85010367-85010389 GGGACTTACTCTAAAGCTATGGG + Intergenic
997278131 5:132615840-132615862 GTGAAGGAATCTACAGGTCTGGG - Intronic
997666361 5:135632571-135632593 GGGAATGTCTCCACAGCACCAGG + Intergenic
999539562 5:152556807-152556829 GGGAATGAGACTAAAGCTTTAGG - Intergenic
1000242277 5:159419483-159419505 GGTGGTGACTCTACAGTTCTGGG + Intergenic
1001524575 5:172419491-172419513 GGGAAGGACACTGCAGCTCCAGG + Intronic
1002107049 5:176884802-176884824 AGGAATTAGTCTACAGCTGTTGG + Intronic
1007600973 6:43081019-43081041 GGGAATGACTGTAAAGCTGAAGG - Intronic
1008887467 6:56446660-56446682 ATGAATGACTCTACAGTTCTTGG - Intergenic
1012163646 6:95921204-95921226 AGGAATGACACTATAGCACTAGG + Intergenic
1013296189 6:108760324-108760346 GGAACTGGCTCCACAGCTCTGGG + Intergenic
1018052866 6:160026798-160026820 GGGAAAGAACCCACAGCTCTGGG - Intronic
1018788526 6:167128088-167128110 GAGAAGGACTCTTCACCTCTAGG + Intronic
1019106005 6:169667659-169667681 GGGACTGGCTCTTCTGCTCTGGG + Intronic
1019992816 7:4703804-4703826 GGGAGTCTCTCTAAAGCTCTCGG - Intronic
1023767553 7:43525747-43525769 GGGAATCACTATAGACCTCTAGG + Intronic
1026320569 7:69264371-69264393 GGGATTGAATCAACAGGTCTTGG - Intergenic
1027566324 7:79799562-79799584 GTTAATGACTCTACAGTACTCGG + Intergenic
1029376524 7:100180392-100180414 GGGAATGGTTCTAGAACTCTGGG - Intronic
1029723045 7:102382880-102382902 GGGAATGGTTCTAGAACTCTGGG + Intronic
1033147277 7:138882254-138882276 GGGAAGGAATGAACAGCTCTAGG + Intronic
1039917005 8:41867530-41867552 GGGCTTGACTCTTGAGCTCTGGG - Intronic
1045882450 8:107057438-107057460 GGGGATGACTCTAGGGCTCTAGG - Intergenic
1047201638 8:122772340-122772362 GGGAGTGACTCAACAGCTGGAGG + Intergenic
1050861731 9:10442498-10442520 AAGAATGACTCTAAAGCTATAGG + Intronic
1055299638 9:74869775-74869797 GGAAATGACTGTAGAGATCTCGG + Intronic
1058707195 9:107647377-107647399 AGAAATGACTGAACAGCTCTTGG + Intergenic
1061429651 9:130523126-130523148 GGGCAACACTCTACAGCTGTGGG + Intergenic
1188612777 X:32119857-32119879 GGGACTGATTCCACAGCCCTGGG + Intronic
1188852902 X:35153451-35153473 GGGAATGACTCTAGAGAGGTGGG + Intergenic
1190852283 X:54257324-54257346 GGGAAGCACTCTCCACCTCTTGG + Intronic
1192142756 X:68659587-68659609 CGGAAAGACTCTGCAGTTCTGGG + Intronic
1196046428 X:111260680-111260702 GGGAAGGAATCCACAGCTTTTGG + Intronic
1197359964 X:125489038-125489060 GGAAATGATTCTACAGCTTTTGG + Intergenic
1199354613 X:146847497-146847519 GAGAAAGACTCTAGAGATCTGGG + Intergenic
1201391079 Y:13498138-13498160 GCAAATGACTCCACAGTTCTGGG + Intergenic