ID: 1134028056

View in Genome Browser
Species Human (GRCh38)
Location 16:10969714-10969736
Sequence CATGCCCAGATGTTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134028056 Original CRISPR CATGCCCAGATGTTGTCTTG GGG Intronic
901059383 1:6465141-6465163 CAGGCCAAGAAGGTGTCTTGGGG + Exonic
902152995 1:14460190-14460212 CTTGGCCAGATGGTGTCTTGTGG - Intergenic
902443304 1:16445442-16445464 CATTGCCAGATGTCCTCTTGGGG + Intronic
904265359 1:29315588-29315610 CATGCCCAAAGGGTGTCCTGAGG + Intronic
905830154 1:41059281-41059303 CGTGCCCAAATGTTGCCTTTTGG + Intronic
907330041 1:53664830-53664852 CATGCCAGGAGGTTTTCTTGGGG + Intronic
911546661 1:99225286-99225308 CTTGCCCAAATGTTGCCTTTTGG - Intergenic
912612834 1:111066241-111066263 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
916384212 1:164249502-164249524 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
918229207 1:182513021-182513043 CATGCCCAAATGTTGCCCTTTGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918922114 1:190726383-190726405 TATGCCTAGATGTAGTTTTGGGG + Intergenic
919835142 1:201568226-201568248 CTTGCCCAGTTTTAGTCTTGTGG + Intergenic
921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG + Intergenic
921863380 1:220062931-220062953 CAGGACCAGATGCTGTGTTGGGG - Exonic
923291878 1:232553398-232553420 CATGCCCAAATGTTGTCTTTTGG - Intronic
924706591 1:246507354-246507376 CATGCGCAGATGGAGTCTGGAGG + Intergenic
1063289706 10:4733006-4733028 TATGCCCAGATTTTCTCTTTTGG - Intergenic
1064600143 10:16985155-16985177 CACACCCAGATGTTGCCTTTTGG + Intronic
1066487055 10:35856216-35856238 TATGCCCAGTTGATGTATTGGGG - Intergenic
1067109610 10:43390955-43390977 CATTCCCAAATGTTCTCTGGTGG + Intronic
1068027650 10:51667905-51667927 CAGGGCCAGATTTTGTCTTCAGG - Intronic
1069736311 10:70657027-70657049 CATGGCCAGATGTGGTCGGGGGG + Intergenic
1071746408 10:88424539-88424561 TATGCCCAGCTGATGACTTGAGG + Intronic
1071912091 10:90247805-90247827 CATGCTCAGGTGTTGGCATGAGG + Intergenic
1072065939 10:91871716-91871738 CATGCACAGATGTCATCTAGAGG + Intergenic
1072457397 10:95588654-95588676 CATGTCCAGAATTTGGCTTGGGG + Intergenic
1073558418 10:104476098-104476120 CATGCCTGGATTTTATCTTGTGG + Intergenic
1075135584 10:119782631-119782653 CATAGCCAGACCTTGTCTTGTGG + Intronic
1076923854 10:133471463-133471485 CAGGTCCAGATGTGGGCTTGGGG + Intergenic
1077590562 11:3487785-3487807 CATGGCCACATGTTCTCTGGGGG - Intergenic
1078560008 11:12363270-12363292 CAAGGCCAGATGTTGTCTGCTGG - Intergenic
1079721542 11:23820521-23820543 CATGAAAAGATGTGGTCTTGGGG + Intergenic
1082927669 11:58568068-58568090 CATGCCCTCATGTGGTCGTGTGG - Intronic
1083710626 11:64546276-64546298 CATGTCCTGATGCTGTCCTGTGG + Intergenic
1084246283 11:67859566-67859588 CATGGCCACATGTTCTCTGGGGG - Intergenic
1084938941 11:72602077-72602099 CCTGACCAGAAGCTGTCTTGGGG - Intronic
1088601714 11:111485145-111485167 AATTCCCAGATATTGTATTGAGG - Intronic
1090798670 11:130156907-130156929 CAAGCCCAGATTTTGGCTTGAGG - Intergenic
1091663201 12:2399679-2399701 CCTGCCCAAATGTTGCCTTTTGG - Intronic
1092416849 12:8296690-8296712 CATGGCCACATGTTCTCTGGGGG - Intergenic
1092489108 12:8929023-8929045 CATGGCAAGAGTTTGTCTTGTGG + Intronic
1093712930 12:22348284-22348306 CATCCCTAGATGCTGTCATGGGG + Intronic
1094496376 12:30991944-30991966 TGTGGCCACATGTTGTCTTGAGG - Exonic
1094624711 12:32112720-32112742 CATGGCCACATTTTGTCTTGGGG + Intronic
1094716382 12:33018757-33018779 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
1095466468 12:42492389-42492411 CATGCCCAGATTTTCCCTTGTGG - Intronic
1095748060 12:45681931-45681953 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
1096558976 12:52422548-52422570 AATCCCCAGATCTTGTCCTGGGG - Intergenic
1098498325 12:71162801-71162823 CATACACAGATGGTGTCTTGGGG + Intronic
1098554587 12:71804208-71804230 CAGGCCCAAATGTTGCCTTTTGG + Intergenic
1099171581 12:79370918-79370940 CATGGGCTGATGTTGTCTTTAGG - Intronic
1103044741 12:117726610-117726632 CATTGCCAAATGTTGTCTAGGGG + Intronic
1108528738 13:51308857-51308879 CATGCACAGACTTTTTCTTGTGG + Intergenic
1109204507 13:59466730-59466752 CATGCCCAAATGTTGCCTTTTGG + Intergenic
1112851279 13:103709333-103709355 CTAGCACAGATGTTGTGTTGAGG + Intergenic
1114953672 14:27790152-27790174 CATCCCCAGATATTGCCTTAGGG - Intergenic
1117390313 14:55256303-55256325 CATGCCCAAATGTTGCCTTTTGG + Intergenic
1118634514 14:67735408-67735430 CTTGCTCAGATGTTAACTTGCGG - Intronic
1119605511 14:76012831-76012853 TTTGTCCAGCTGTTGTCTTGGGG + Intronic
1119614416 14:76089458-76089480 CTTGGCCAGGTGTTTTCTTGTGG - Intergenic
1119645652 14:76346537-76346559 CAAGCCCCCATGGTGTCTTGAGG - Intronic
1121159626 14:91725841-91725863 CGTGCCCAGAAGTTGCCTTTTGG + Intronic
1121666478 14:95676388-95676410 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
1122306029 14:100767238-100767260 CATGCCCATATGTTGGCATATGG + Intergenic
1123959917 15:25386627-25386649 TATGCCCAGATGTAGTTTTTTGG - Intronic
1124446730 15:29740828-29740850 CATTGCCAGATGTTTCCTTGGGG - Intronic
1125113161 15:36057533-36057555 CAATCCCAGATATTGTCCTGTGG - Intergenic
1128224124 15:65989821-65989843 CATTTCCAGATGCTGTCTTGGGG - Intronic
1131986114 15:98044164-98044186 CAGGCTCGGCTGTTGTCTTGTGG + Intergenic
1133355931 16:5136870-5136892 CATGGCCACATGTTCTCTGGGGG - Intergenic
1133564243 16:6978118-6978140 CATGCCCGGCTGTTGTGTTCAGG - Intronic
1134028056 16:10969714-10969736 CATGCCCAGATGTTGTCTTGGGG + Intronic
1134187250 16:12094382-12094404 AAGGCCCAGATGTTGTTTTCAGG - Intronic
1134401104 16:13910506-13910528 CAAGCCCAGATGGTGTTTTTAGG - Intergenic
1137927132 16:52550543-52550565 TATGCCCAGAAGTTGTATTTTGG - Intergenic
1141888804 16:86912504-86912526 CACGCACAGATGTCGGCTTGTGG - Intergenic
1144635829 17:16908396-16908418 CATGACCAGAAATTGTCATGTGG + Intergenic
1147443170 17:40459869-40459891 CAAGCCCTGATGTTGGCTGGGGG + Intergenic
1149413232 17:56430874-56430896 CAGGACCCAATGTTGTCTTGGGG + Intronic
1149959673 17:61094275-61094297 AATGCACAGTAGTTGTCTTGAGG + Intronic
1150261685 17:63797607-63797629 CATTGCCAGATGTTGCCTAGGGG + Intronic
1150499440 17:65636517-65636539 GAGGACAAGATGTTGTCTTGAGG - Intronic
1154155962 18:11944287-11944309 CATGCCCACAAGTTGTCTTTTGG - Intergenic
1157722173 18:49933565-49933587 CATTGCCAAATGTTCTCTTGGGG - Intronic
1158496705 18:57961590-57961612 CAGGCCCAGGTCTTGTATTGAGG - Intergenic
1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG + Intronic
1166716654 19:44972895-44972917 CCTCCCCAGATGTGGTCTTTAGG + Intronic
1168260796 19:55193272-55193294 CATGCCCAGCTATTTTGTTGGGG - Intronic
928187995 2:29132311-29132333 TATGCCCATATATTGTCTGGGGG + Intronic
928664458 2:33536888-33536910 CACCCCTAGATGCTGTCTTGGGG - Intronic
930675821 2:54199283-54199305 CATACCCACATGGGGTCTTGAGG + Intronic
931452995 2:62384157-62384179 CAGGTCCAGATGGTGTCATGTGG + Intergenic
932306108 2:70705253-70705275 TGTGCCCAGATATTGTGTTGGGG - Intronic
941852187 2:170195248-170195270 CATGCCCAAAAGTTGGCTTTTGG + Intronic
942125648 2:172822582-172822604 AATGCCCAGATGCTGTATGGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
943116890 2:183683754-183683776 AATTCCCACATGTTGTGTTGTGG - Intergenic
948118411 2:235511034-235511056 CATGGCCAAATGTCCTCTTGGGG - Intronic
948642909 2:239386592-239386614 CAGGCCCAGACGTGGTCTGGCGG - Intronic
1170357442 20:15507814-15507836 CAACCCTTGATGTTGTCTTGGGG - Intronic
1170894831 20:20403633-20403655 CATGCCCAGATGTTACCTGGAGG + Intronic
1173369888 20:42426183-42426205 CATGCCCAAATGTGGCCTTTTGG + Intronic
1173842664 20:46168276-46168298 CATGCCCAGACGTGGGATTGTGG - Intergenic
1175168449 20:57062906-57062928 CATGCCCAAATGTTGCCTTTTGG - Intergenic
1175838134 20:62009388-62009410 CATTCCTAGATGTGGCCTTGCGG - Intronic
1177540262 21:22483831-22483853 AATGCCCAGGTGATGTGTTGAGG - Intergenic
1180702238 22:17787837-17787859 CCTGCCCAGATGATGCCTTCAGG - Exonic
1183088593 22:35505244-35505266 CCCACCCAGATGTTGTCTTTGGG + Intergenic
1183105503 22:35612275-35612297 CATGCCCAGAAGTTGTCACAAGG + Intronic
1185307293 22:50126995-50127017 CCTGCCAAGATGTTGTCTTCTGG - Intronic
950327043 3:12120592-12120614 CATGGCCAGGTGTGGTTTTGGGG + Intronic
952633429 3:35497976-35497998 CATGCACAGGTGTAGTTTTGTGG + Intergenic
953595780 3:44311917-44311939 CATTCACAGAGGTTGTCTTTAGG + Intronic
953673216 3:44979984-44980006 CACTCCCAGTAGTTGTCTTGGGG - Intronic
956504099 3:69919504-69919526 CATGCACAAATGTTGTCTTGGGG - Intronic
957824539 3:85423315-85423337 CATGCCCAAATACTGTCTTCTGG - Intronic
959065245 3:101649158-101649180 CATGCCCAAATGTTGCCTTTTGG - Exonic
960297311 3:115959976-115959998 CATGGGGAGATGGTGTCTTGGGG + Intronic
961077298 3:123993740-123993762 CATCCCCAGATCTTGCCCTGTGG - Intergenic
961307278 3:125967581-125967603 CATCCCCAGATCTTGCCCTGTGG + Intergenic
961343158 3:126243890-126243912 CATGCCCAAAAGTTGCCTTTTGG - Intergenic
961894402 3:130155291-130155313 CATGGCCACATGTTCTCTTGGGG - Intergenic
965791712 3:172395624-172395646 CATGCCTACTTGTTTTCTTGAGG - Intronic
966748365 3:183299495-183299517 CTTCCTCAGAGGTTGTCTTGAGG + Intronic
969004491 4:4008370-4008392 CATGGCCACATGTTCTCTGGGGG - Intergenic
969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG + Intergenic
969809408 4:9636337-9636359 CATGGCCACATGTTCTCTGGGGG + Intergenic
974368679 4:60985935-60985957 CATGTCCAAATGTTGCCTTTTGG - Intergenic
974847816 4:67372150-67372172 CATGTGCAGAAGTTCTCTTGAGG - Intergenic
974897464 4:67956877-67956899 AATTCCCATATGTTGTGTTGTGG + Intronic
977701108 4:100023974-100023996 CATGCCCAGATGATGGGTTAAGG + Intergenic
983515636 4:168653625-168653647 CATACTCAAAGGTTGTCTTGTGG - Intronic
983626196 4:169804308-169804330 CACCTCCAGATGTTGTGTTGAGG + Intergenic
983810236 4:172051717-172051739 CATGCCCAAAAGTTGCCTTTTGG - Intronic
987943388 5:24571842-24571864 CATGCCCAGCTGAGGTCATGGGG - Intronic
988090866 5:26539404-26539426 CATGCCCAGATCTCCTGTTGAGG + Intergenic
989719085 5:44503811-44503833 CATGACCAAAAGTTGTCTTTTGG + Intergenic
990499063 5:56376790-56376812 CATGCCCAAATGTTGTATTTTGG - Intergenic
993057161 5:82994783-82994805 AATCCCAAGATTTTGTCTTGAGG - Intergenic
994819259 5:104627911-104627933 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
995644728 5:114298663-114298685 TATACCCAGATGTTGCTTTGGGG + Intergenic
997417247 5:133738620-133738642 CAGGCCCTGATGCTGTCTTACGG + Intergenic
997420826 5:133765523-133765545 CAGGCCCTGATGTTGGCCTGAGG - Intergenic
998887929 5:146713987-146714009 CAAGACCAGATGAGGTCTTGGGG + Intronic
1000135408 5:158344534-158344556 CATGTCCAGATGATTTCATGGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002373458 5:178772530-178772552 CGTGCCCAGAGGCTGTCTTCAGG + Intergenic
1002424537 5:179167376-179167398 GAGGCCCAGAGGCTGTCTTGGGG - Intronic
1002762607 6:213809-213831 CATGCCCAAAAGTTGCCTTCTGG + Intergenic
1003447093 6:6194543-6194565 CCTTCCTAGATGGTGTCTTGTGG + Intronic
1003687902 6:8322868-8322890 CATGCCCAAATGTTGCCTTTTGG - Intergenic
1007679506 6:43624701-43624723 CAGCCCCAGATGTTCCCTTGTGG + Exonic
1008777699 6:55061585-55061607 CAGGCCCTGATGTTGTGTGGAGG + Intergenic
1011061016 6:83268479-83268501 CATTCCCAAAAGTTCTCTTGTGG + Intronic
1012042939 6:94233778-94233800 CATGCCCAAAAGTTGCCTTTTGG + Intergenic
1016117407 6:140303873-140303895 CATGCCCAAATATTGTCTTTTGG - Intergenic
1016534023 6:145090861-145090883 CATGCCCGAATGTTGCCTTTTGG - Intergenic
1017448563 6:154531552-154531574 CTTTGCCAGATGTTTTCTTGGGG - Intergenic
1020021511 7:4872214-4872236 CATGGCCAGATGTTCCCTGGAGG - Intronic
1020324627 7:6964869-6964891 CATGGCCACATGTTCTCTGGGGG - Intergenic
1020390376 7:7651380-7651402 CATACCCAAATGTTGCCTTTTGG - Intronic
1020515502 7:9113063-9113085 GATTCCCTGATGTTTTCTTGTGG - Intergenic
1022035155 7:26527207-26527229 CATGGGCAGATGTGGGCTTGGGG + Intergenic
1025003464 7:55337377-55337399 CATGCCCAAATATTGCCTTTTGG - Intergenic
1029017241 7:97327275-97327297 CATGCCCAAATGTTGCCTTTTGG + Intergenic
1030117573 7:106073869-106073891 CATGCCCAAATGTTGCCTTTTGG + Intergenic
1030387125 7:108877989-108878011 CATGCCCATATGTTGCCTTTTGG + Intergenic
1030819094 7:114075636-114075658 CTTGCCCAGATTCTCTCTTGAGG + Intronic
1031076636 7:117219621-117219643 CATGGCCAGATGTGGAGTTGTGG + Intronic
1031910131 7:127507541-127507563 CATGCCCTGAATTTGTTTTGAGG - Intergenic
1033881346 7:145887388-145887410 CTTGCCCAAATGTTGCCTTTTGG - Intergenic
1034266464 7:149783428-149783450 CAAGCCCAGAGGTGGTATTGGGG + Intergenic
1035824713 8:2631897-2631919 CACACCCAAATGTTGCCTTGTGG - Intergenic
1039039653 8:33395236-33395258 CCTGCCCAAATGTTGCCTTTTGG + Intronic
1039150786 8:34502890-34502912 TATGCCCGGCTGTTGTCTAGTGG + Intergenic
1039306370 8:36267588-36267610 CATGCCCAAATGTTGCCTTTTGG - Intergenic
1039456322 8:37709883-37709905 CTTGGCCAGATGCTGTCCTGTGG - Intergenic
1041433895 8:57817122-57817144 CAGGGCAAGATGTTGTCTGGTGG - Intergenic
1042348562 8:67752015-67752037 CATGCCCAAAAGTTGCCTTTTGG - Intergenic
1044817680 8:96129956-96129978 AATGCCCTGATTTTGTTTTGGGG - Intergenic
1044833475 8:96273312-96273334 CCTCTCCAGATGTTGTCTTCTGG - Exonic
1045658531 8:104411786-104411808 CCTCCCCAGATGTGCTCTTGAGG - Intronic
1046567216 8:115917417-115917439 CATGCCCAAATGTTGTCTTTTGG + Intergenic
1049498384 8:142947403-142947425 CCTGCCCAGATGTTGGCCTAAGG + Intergenic
1050041810 9:1503861-1503883 CATGCCCAGAAGTTGCCTTTTGG + Intergenic
1050247442 9:3705461-3705483 AATGCCCAGAGATTGTGTTGAGG - Intergenic
1052793615 9:32902044-32902066 CAGGCCCATATGTTGCCTTTTGG + Intergenic
1055406212 9:75976377-75976399 CATGCCAAGATGCTTTCTAGAGG - Intronic
1059135498 9:111802919-111802941 CATGCCCAAATGTCCGCTTGAGG - Intergenic
1059525082 9:114984001-114984023 CATTGCCAAATGTTTTCTTGGGG + Intergenic
1059917859 9:119123782-119123804 CATTGCCATATGTTCTCTTGGGG + Intergenic
1186247306 X:7627922-7627944 CATGCTCATGTGTGGTCTTGTGG + Intergenic
1189413061 X:40790941-40790963 CATCCCTAGAAGCTGTCTTGGGG - Intergenic
1193439195 X:81517534-81517556 TTTTCCCAGATGTTTTCTTGTGG - Intergenic
1193709335 X:84860527-84860549 AGTGCCCAGATGTTGCCTTTTGG + Intergenic
1196093990 X:111778480-111778502 CATTGCCAAATGTGGTCTTGGGG + Intronic
1196696000 X:118612691-118612713 CATGCTCAACTCTTGTCTTGGGG - Intronic