ID: 1134029788

View in Genome Browser
Species Human (GRCh38)
Location 16:10982599-10982621
Sequence TTGGCTTCACCCAGCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134029785_1134029788 -8 Left 1134029785 16:10982584-10982606 CCACTTCAGCCGGATTTGGCTTC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG 0: 1
1: 0
2: 0
3: 12
4: 129
1134029782_1134029788 2 Left 1134029782 16:10982574-10982596 CCGCATTGCTCCACTTCAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG 0: 1
1: 0
2: 0
3: 12
4: 129
1134029781_1134029788 3 Left 1134029781 16:10982573-10982595 CCCGCATTGCTCCACTTCAGCCG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134029788 Original CRISPR TTGGCTTCACCCAGCCATGA GGG Intronic
900540047 1:3198023-3198045 TTGGCCTCAACCAGAGATGAGGG + Intronic
902147697 1:14417564-14417586 TTGACTCCAACCAGCCAGGAGGG - Intergenic
903472126 1:23594633-23594655 TTCCATTCACCCAGCCATGAGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906565509 1:46798343-46798365 GTGGCTCCATCCAGCCAGGAGGG + Intronic
908788416 1:67757542-67757564 TTGGCATCTTCCAGCCATGTCGG - Intronic
910071367 1:83218243-83218265 TAGGCTTCAGCCAGCCAGGTGGG - Intergenic
913032414 1:114922567-114922589 CAGGCATCACCAAGCCATGAGGG + Intronic
916468630 1:165098784-165098806 TTGGCTTCCCTGAGCCATGTTGG + Intergenic
917859659 1:179134257-179134279 TTGGCTTCAGCCAGGCACGGTGG + Intronic
920729218 1:208467208-208467230 TTGCCTCCACCCAACCATGATGG + Intergenic
921097082 1:211895795-211895817 TTGACTTCTCCCAGTCCTGAGGG - Intergenic
922383066 1:225052895-225052917 TTGGCTTCACGAAGCCATCAGGG + Intronic
1063568698 10:7194909-7194931 TTGGCTTCAGCCTGTCTTGAGGG - Intronic
1064272317 10:13877022-13877044 GTGGCTTCACCCATCACTGAGGG - Intronic
1067139668 10:43646594-43646616 TTGGCTCCAACCAATCATGAAGG - Intronic
1070669980 10:78370969-78370991 TTGGCTTTGCGCAGCTATGATGG + Intergenic
1070900827 10:80027518-80027540 ATGGATTCACCCATTCATGAAGG + Intergenic
1070901536 10:80034035-80034057 ATGGATTCACCCATTCATGAAGG + Intergenic
1072686417 10:97539962-97539984 TTGGCTGCACCCAGCCCTCTGGG - Intronic
1074504279 10:114054183-114054205 TGGGTTGCACCCAGCCAAGACGG + Intergenic
1075420530 10:122297269-122297291 TTTGGCTCACCCACCCATGAAGG - Intronic
1077091089 11:778570-778592 TTGGCTGTTCCCAACCATGACGG - Intronic
1081603309 11:44510633-44510655 GTGGCTCCACCCAGCCACAAGGG + Intergenic
1083610915 11:64003924-64003946 TTGGCTGCCCCCAGCGCTGACGG + Intronic
1083971995 11:66083865-66083887 TTGGCTTTACCCCACCATGTGGG + Intronic
1086097272 11:83063059-83063081 TTTGCTTCACCCAGCCACAGTGG + Intronic
1086401121 11:86461618-86461640 CTGGCCTCACCCAGTGATGAGGG - Intronic
1089343634 11:117776472-117776494 TTTGCTTGACCCAGCCCTGAGGG - Intronic
1094276520 12:28682830-28682852 TAGGCTTCACCCAGTCATTCTGG + Intergenic
1096664122 12:53150954-53150976 GTGGCTTCACCCAGGAAAGAGGG + Intergenic
1098793644 12:74860760-74860782 GTGGCTATTCCCAGCCATGAGGG - Intergenic
1100569419 12:95833016-95833038 TTGCCTTAACCGAGTCATGAAGG - Intergenic
1100965757 12:100011186-100011208 TGGGCTCCACCCAGCAATGGTGG - Intergenic
1102009358 12:109608501-109608523 CTGACATCACCCAGCCAGGAAGG + Intergenic
1102177437 12:110886580-110886602 TTGGCTGCACCCCTCCAGGAAGG - Intronic
1103535433 12:121630485-121630507 CTGGCTTCAGCCAGGCATGGTGG - Intronic
1104378273 12:128284511-128284533 TTGGCTTCACATAGGCTTGAGGG - Intronic
1107389702 13:39951401-39951423 TTGGCCACACCCAGCCCTGGAGG - Intergenic
1108421358 13:50253081-50253103 ATGTCCTCACCCAGCCATGTGGG + Intronic
1108787441 13:53921629-53921651 CTGGTTCCACCCAGCCATGCAGG + Intergenic
1110976254 13:81839403-81839425 GTAGCTTCACCAAGCCATGAAGG - Intergenic
1114516875 14:23306327-23306349 TGGGCTTCAGCCAGGCATTAGGG - Intronic
1121709443 14:96026745-96026767 ATGTCTTCACGGAGCCATGAAGG + Intergenic
1126962641 15:54014905-54014927 TTGGATTCATCCACCCAGGAAGG + Exonic
1127473834 15:59313923-59313945 TGGGCGTAACCCAGCCATTATGG - Intronic
1128146701 15:65335948-65335970 TTCTCTTCCCCCAGCCATGTCGG - Exonic
1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG + Intronic
1137449675 16:48559762-48559784 AGAGCTTCACCCAGCAATGAGGG - Intronic
1138070819 16:53991398-53991420 CTGGCTTCTCCCGGCCATCATGG - Intronic
1142135298 16:88449251-88449273 CTGGCTTCACCCTTCCATCAGGG + Intergenic
1142700876 17:1659841-1659863 TTGGAGTCAGCCAGCAATGAGGG + Exonic
1148558195 17:48591059-48591081 TTGGAGTCCCCCAGGCATGAAGG + Intronic
1149827025 17:59838030-59838052 TTGGTTTCTCCCAGACATGTTGG + Intronic
1151340472 17:73467664-73467686 AAGGTTTCACCCAGCCAGGATGG - Intronic
1152571687 17:81123862-81123884 GTGGCTTCACCCAGCCACTTTGG + Intronic
1152597501 17:81244990-81245012 TTGCCTTCACCCAGCCTCGGTGG - Exonic
1156177972 18:34569747-34569769 TTGACTTCCCCCAACCAAGAAGG - Intronic
1156454116 18:37283227-37283249 TTGGAGCCACCCAGGCATGACGG + Intronic
1156867497 18:41905111-41905133 TTTGCCTCACCCTACCATGAAGG + Intergenic
1158072404 18:53488424-53488446 TTGGCTTGTACCAGTCATGATGG - Intronic
1160582345 18:79891293-79891315 GTGGCTTCAGTAAGCCATGATGG - Intronic
1160866763 19:1259650-1259672 CTGGCTTGACCCAGCCCTGGGGG + Intronic
1163195254 19:15714932-15714954 AAGGCTGCACCAAGCCATGAGGG + Intergenic
1164055547 19:21619197-21619219 TTAGCTTCAGCCAGGCATGGTGG - Intergenic
1165596450 19:37014160-37014182 TTTCCTTCACCCAGCCAAAACGG + Intronic
926134282 2:10325750-10325772 CGGGCTTCTCCCAGCCAGGAAGG - Intronic
926809850 2:16746484-16746506 TTTGCTGCACCCAACGATGAGGG - Intergenic
928854243 2:35785105-35785127 TAGGCTTCACCCTGCCACCAGGG + Intergenic
929083016 2:38139568-38139590 TGGCCTCCACCCAGCCCTGATGG - Intergenic
933297088 2:80503106-80503128 GAGGCTGCACTCAGCCATGATGG + Intronic
933467247 2:82668958-82668980 TTGGCTTCTCTGAGCCATGTTGG + Intergenic
933660742 2:84925518-84925540 TTGGCCTCCCCAAGCCAAGAGGG + Intergenic
934828215 2:97490316-97490338 TTGAATTCTCCCTGCCATGAAGG - Intergenic
936927819 2:117755800-117755822 TTGGCTTAAGCCAGACAAGAGGG - Intergenic
937144327 2:119629440-119629462 GTGGCTTCAACCTGCCATGGAGG + Intronic
939601712 2:144200441-144200463 TTGGCTTCTCTCAGCCATGTTGG + Intronic
941006957 2:160257923-160257945 TTGGATTCACCCTGCCTTAAAGG + Intronic
941013420 2:160327297-160327319 ATGGATTCACCCAGGCATGTTGG - Intronic
1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG + Intergenic
1171499354 20:25581189-25581211 TTGGCTTCCCAAAGCGATGATGG - Intronic
1172197288 20:33100583-33100605 TTGGGTTTACCCAGCCCTGATGG - Intronic
1176256791 20:64157152-64157174 GTGGCTACACGCAGCCCTGAGGG + Intronic
1177961374 21:27670836-27670858 TTGGCTTTACCCAACCATAGAGG - Intergenic
1178785438 21:35649170-35649192 TTGGCTAGACCCAGTCATGTCGG - Intronic
1178941065 21:36906465-36906487 TAGGCTGCAACAAGCCATGATGG + Intronic
1179731954 21:43373036-43373058 TTGGCTTCACCTGGCTCTGAGGG - Intergenic
1181027902 22:20136137-20136159 TTGGCTGGAGCCAGCCAGGAGGG + Intronic
1181047089 22:20220287-20220309 CTGGCTTGACCAAGCCAGGAAGG - Intergenic
949113568 3:292845-292867 TGGACAGCACCCAGCCATGAGGG + Intronic
952679414 3:36074009-36074031 AAGGCTTCACCCAGTGATGAGGG + Intergenic
954698954 3:52441805-52441827 TGGGCATCACCCACCTATGAAGG + Exonic
961538404 3:127584075-127584097 TTGGCTTCACCTTGCTGTGAGGG - Intronic
964016916 3:151958985-151959007 TTGACTGCACCTAGCCATGCAGG - Intergenic
964913118 3:161805940-161805962 TTCCTTTCACCCAGCCATAAAGG - Intergenic
965589719 3:170350966-170350988 TTGGCTTAAGCTAGCCATCATGG - Intergenic
966300281 3:178471288-178471310 CTTGCTTCCCCCAGCTATGAAGG + Intronic
967777660 3:193401029-193401051 ATGGTGTCTCCCAGCCATGAGGG - Intergenic
969279323 4:6159022-6159044 TAGGCTGCATTCAGCCATGATGG + Intronic
975143750 4:70944850-70944872 TAGACATCACCAAGCCATGAAGG + Intronic
975437971 4:74375837-74375859 TTGGCCACATCCATCCATGATGG + Intronic
976018294 4:80587655-80587677 TTGGCTGCAGTGAGCCATGATGG - Intronic
976359414 4:84159999-84160021 TTGGCTTCAGCCAGGCAGGAGGG + Intergenic
977839684 4:101687461-101687483 GTGGCTTCTCCCTGCAATGATGG + Intronic
978227585 4:106356021-106356043 TTGGCTTCAGGCATCCATTAGGG - Intergenic
981361750 4:143853906-143853928 TTGGCTTCCCTGAGCCATGCTGG + Intergenic
986402186 5:7393666-7393688 TTGTCTTCACCCACTCAAGAAGG - Intergenic
987840244 5:23214107-23214129 CTGGCTTAACCCAGACAGGAGGG - Intergenic
989165980 5:38433931-38433953 CTGGCTGGACCCAGCCATGGGGG + Intronic
990044603 5:51413902-51413924 TTTGCTTCACCCAGGGATAATGG - Intergenic
992067057 5:73118838-73118860 TTGGCATCACAAGGCCATGAGGG + Intergenic
992138762 5:73773953-73773975 TTGGCTTTACCCAACGAAGAGGG + Exonic
993491582 5:88558193-88558215 TTCCCATCTCCCAGCCATGATGG - Intergenic
998265422 5:140664516-140664538 TGGGTTTCACCAAGCCACGAAGG + Intergenic
998896457 5:146805282-146805304 TTCTCTTTACCCAGCAATGATGG + Intronic
1006415942 6:33904002-33904024 TGGCTTTCACCCAGCCCTGAGGG - Intergenic
1008560151 6:52715870-52715892 TGGGCTTCTCACAGCCATGGTGG + Intergenic
1008632098 6:53371881-53371903 TTGGCTTCTGCCAGCCACGGTGG + Intergenic
1013178038 6:107693950-107693972 CTGGCCTCACCCAGCCATAGAGG + Intergenic
1016613053 6:146015035-146015057 TTGTCTTCTCCCTGCCATGCTGG - Intergenic
1017148110 6:151252839-151252861 TTAGGTGCACCCAGCCATGCTGG - Intronic
1018397368 6:163388664-163388686 TGGGCTTCAACCAGTCTTGAAGG + Intergenic
1018792312 6:167157825-167157847 ATGGCATCACCCGGCCGTGAGGG + Exonic
1026352121 7:69526501-69526523 TTGGCTGCACCCACCCAGGATGG + Intergenic
1027289080 7:76683195-76683217 TAGGCTTCAGCCAGCCAGGTGGG - Intergenic
1031251691 7:119390967-119390989 ATGGATTAACCCAGTCATGAGGG + Intergenic
1032120209 7:129149965-129149987 TTGGCTTCATCCAGATATAAGGG + Intronic
1035279472 7:157768510-157768532 TTGTCTTCAAGGAGCCATGATGG + Intronic
1038329006 8:26592985-26593007 ATGGCTTCACCCAACAATCACGG - Intronic
1042678404 8:71349312-71349334 ATGGCATCATTCAGCCATGAAGG + Intronic
1044751586 8:95421773-95421795 TTGGCTGTGCCCAGCCAGGAGGG + Intergenic
1047047122 8:121066652-121066674 TTAGCTTCATCCATCCATAATGG - Intergenic
1049606219 8:143530350-143530372 TCTGCTTCACCCACCCAGGATGG - Intronic
1051787630 9:20762864-20762886 TTGGGTTCACACAGACATGAAGG - Intronic
1052120006 9:24702880-24702902 TTGGCTGCACCCACCCAGGATGG - Intergenic
1055056251 9:72026955-72026977 TTGGCTTCAGCCAGGTATGGTGG - Intergenic
1056786544 9:89596733-89596755 TCGGCTCCACACAGCCATGCAGG + Intergenic
1057978330 9:99630726-99630748 TTGGCTTCACGCAGCCAAAAAGG - Intergenic
1190741050 X:53289034-53289056 TTGGCATGACCCAGGCCTGAGGG - Intronic
1194069345 X:89300860-89300882 TTGGCTCCACGTAGCTATGATGG - Intergenic
1198692369 X:139298254-139298276 TTGGCTTAAAACATCCATGAAGG + Intergenic
1200786886 Y:7268411-7268433 TTGTTTTCACCTAGGCATGATGG - Intergenic