ID: 1134034600

View in Genome Browser
Species Human (GRCh38)
Location 16:11020236-11020258
Sequence GGCCGCCAGCACCTCCGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134034597_1134034600 24 Left 1134034597 16:11020189-11020211 CCAGAGATCGAGATGGTGATCAT 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG 0: 1
1: 0
2: 2
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134034600 Original CRISPR GGCCGCCAGCACCTCCGTGC AGG Exonic
900349887 1:2229359-2229381 GGCGGCCAGCTCCTTCTTGCAGG - Exonic
900457666 1:2785389-2785411 AGCAGGCAGCACCCCCGTGCTGG + Intronic
900488603 1:2935329-2935351 AGCCCCCAGCTCCTCCCTGCTGG + Intergenic
900654348 1:3747535-3747557 GGCAGTCAGCACCTGGGTGCAGG - Intergenic
901772266 1:11536509-11536531 GACCGTCAGCACCGCCCTGCTGG + Exonic
902640477 1:17763392-17763414 GGATGCCAGCACCTCCGGGGAGG - Intronic
902746987 1:18481034-18481056 GGCTGACAGCACCACCTTGCCGG - Exonic
903466926 1:23558397-23558419 GGGCGCCAGCACCTGCGTTCTGG + Exonic
912551733 1:110489481-110489503 GGACACCGGCACCTCCCTGCTGG + Intergenic
912905280 1:113699181-113699203 GGCAGCCTGCATCTCTGTGCTGG - Intronic
914753018 1:150548885-150548907 GGCCGCGGGTACCTCCGTCCAGG + Intergenic
916181102 1:162084501-162084523 GGCCTCCTCCACCTCCTTGCTGG - Intronic
916490500 1:165298176-165298198 GCCCGCCAGCGCCTCAGTGCAGG + Intronic
916589414 1:166176029-166176051 GGCCACCAGCTCCTCCCTGCAGG + Intergenic
917834743 1:178932463-178932485 CACCCCCTGCACCTCCGTGCAGG + Intergenic
918041747 1:180917876-180917898 GGCCTCGGGCACCTCCTTGCAGG + Exonic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922413437 1:225397540-225397562 GGCCACCAGCTCCTCCAGGCTGG + Intronic
923098492 1:230793994-230794016 GGCAGCCAGCACTGCCGTGCAGG + Intronic
923171434 1:231421436-231421458 GGCCGGCGGCTCCTCCTTGCCGG + Exonic
923500511 1:234560101-234560123 GGCCGCCAGCTGGTCTGTGCTGG - Intergenic
1062910398 10:1208463-1208485 GGCTGCCTGCACCTGAGTGCTGG - Intronic
1065814696 10:29473165-29473187 GGGCTCCAGCACCTTCGTGATGG - Intronic
1067323999 10:45249120-45249142 GGCCGCCCGCACCTCACTGCTGG + Intergenic
1069756931 10:70779151-70779173 GGCTTCCAGCACCTCAGTGGTGG + Intronic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1073052908 10:100680922-100680944 GGCCGCCGCCACCTCTGTCCAGG - Intergenic
1074185605 10:111097578-111097600 GACCCCCAGCACTTCAGTGCGGG - Intergenic
1076247838 10:128961502-128961524 GGCCGCCAGCACCTGTGTGGAGG + Intergenic
1076949185 10:133668954-133668976 CGCCGCCAGGCGCTCCGTGCTGG - Intronic
1076950169 10:133672253-133672275 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076953132 10:133682172-133682194 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076954116 10:133685471-133685493 GACCGCCAGGCGCTCCGTGCTGG - Intergenic
1076955100 10:133741823-133741845 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076957078 10:133748442-133748464 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076959051 10:133755051-133755073 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076960040 10:133758361-133758383 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
1076961024 10:133761660-133761682 GACCGCCAGGCGCTCCGTGCTGG - Intergenic
1081774561 11:45668523-45668545 GACCTCCAGCTCCTCCCTGCAGG - Intergenic
1083794477 11:65007087-65007109 GGCAGCCAGGTCCTCAGTGCTGG - Intergenic
1083841528 11:65307605-65307627 GGCCACCAGCAGCTCTGGGCTGG + Intergenic
1084044731 11:66562013-66562035 GACCGCCAGCACATCCGCGTGGG + Exonic
1084179078 11:67437622-67437644 GTCCGCAGGCCCCTCCGTGCCGG + Exonic
1084574952 11:69983118-69983140 GGCCACCAGCACCATCATGCAGG - Intergenic
1090906851 11:131084275-131084297 GGCCCCCACCACCTCCCTCCCGG + Intergenic
1091672388 12:2461837-2461859 GGCCGCCCTCGCCTCCGTCCTGG + Intronic
1091817747 12:3452815-3452837 GGCAGCCAGCACTTCCCAGCAGG - Intronic
1095670731 12:44857203-44857225 GGCCCCCAGCAACTCTGTGCTGG - Intronic
1103901668 12:124306666-124306688 TGCTGCCAGCAGCTGCGTGCTGG + Intronic
1105015800 12:132786287-132786309 GGTCACCAGCCCCTCAGTGCAGG - Intronic
1112321313 13:98410211-98410233 GGCAGCCAGCCCCACCGTGGAGG - Intronic
1113014394 13:105811293-105811315 TGCCGCCAGCATCTCCTTGACGG - Intergenic
1113625878 13:111845993-111846015 AGCAGCCAGCAGCTGCGTGCAGG - Intergenic
1113670246 13:112171169-112171191 GGCCTCCTGCACCTATGTGCTGG - Intergenic
1114035863 14:18626805-18626827 GGCCGCTGGCACGTCCGGGCCGG + Intergenic
1116114427 14:40629589-40629611 GTCCGCCTGCAGCCCCGTGCGGG - Intergenic
1117875685 14:60248832-60248854 GATCGACAGCCCCTCCGTGCCGG - Intronic
1118619273 14:67600048-67600070 GGCCGCCAGCCACACCGTGCAGG + Exonic
1119024212 14:71139791-71139813 GGCAGCCAGCCTCTCGGTGCAGG + Intergenic
1121226210 14:92323543-92323565 GGCCGCCAGCGCCACCGTGCCGG + Intronic
1121278658 14:92685129-92685151 GGCCTCCCGCTCCTCCGTACAGG + Exonic
1122165866 14:99823294-99823316 GGCCGACACCACCCACGTGCAGG - Intronic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1123719912 15:23050474-23050496 GGCCTCCAGCACCTCTGGCCAGG - Intergenic
1124722518 15:32122209-32122231 GGCCTCCAGCAACTCCCTCCTGG - Intronic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1125380249 15:39079692-39079714 GGCCGTCAGCACCTCTGTGCTGG + Intergenic
1127514320 15:59676890-59676912 GGCTGCCAGCCACACCGTGCAGG - Intronic
1127566368 15:60193152-60193174 TGCCCCCAGCACCTCAATGCTGG + Intergenic
1128104485 15:65033209-65033231 GGTGGGCAGCACCTCCTTGCGGG - Intergenic
1128111297 15:65077757-65077779 GGCCGACACCACCGCCGTGGTGG + Exonic
1129262740 15:74377941-74377963 GGCCACCAGCACCTATGAGCCGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132556386 16:574544-574566 GGCAGCCAGGCCCCCCGTGCTGG - Exonic
1132742352 16:1421118-1421140 GGGCGCCCGCACCTCTCTGCCGG + Intergenic
1132785904 16:1656888-1656910 GGCCGCCAGGACCCCCGCCCCGG + Exonic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG + Exonic
1136424330 16:30159146-30159168 GGCCGCCACCCCGTCTGTGCTGG + Intergenic
1137602787 16:49768067-49768089 GGCCAGCCGCACCTCCGTACAGG - Intronic
1141615325 16:85206768-85206790 GGGGGCCAGCACCTCCATCCTGG - Intergenic
1141615335 16:85206793-85206815 GGGGGCCAGCACCTCCATCCTGG - Intergenic
1141901420 16:86993633-86993655 AGGCTCCAGCCCCTCCGTGCTGG + Intergenic
1142190758 16:88716277-88716299 ACCTGCCAGCACCTCCCTGCAGG - Exonic
1142203963 16:88773923-88773945 GACCACCAACACCTCCCTGCAGG + Intronic
1143200869 17:5112167-5112189 GTCCGCCAGCACCGCCCTTCAGG - Exonic
1145876037 17:28318981-28319003 GGCCGCCAGGAGCGCCGTGTGGG - Intergenic
1149891251 17:60392105-60392127 CGCCGCCACCGCCTCCATGCCGG + Exonic
1152239226 17:79152902-79152924 GGCTGCCAGCACTCCTGTGCTGG + Intronic
1152532558 17:80927870-80927892 ACCCTCCAGCTCCTCCGTGCGGG - Intronic
1152661576 17:81544769-81544791 GGCCGCCAGCACCGACCTGCCGG + Intronic
1152722578 17:81930112-81930134 GGACGCTAGCACCTCCCTCCCGG - Intergenic
1152928837 17:83099927-83099949 GGCGGCCATCCCCTCCCTGCTGG - Intergenic
1152965628 18:111827-111849 GACCGCCAGGCGCTCCGTGCTGG + Intergenic
1154382940 18:13869029-13869051 GGCTGCCAGCACATAGGTGCAGG - Intergenic
1157472704 18:48002367-48002389 GGCCTCCAGCACTTCCGAGATGG + Intergenic
1160951222 19:1668611-1668633 GTCAGCCAGCACCTCTGTGCTGG + Intergenic
1160984765 19:1833516-1833538 GGCTGCCAGTTCCTCTGTGCGGG + Intronic
1161250602 19:3278055-3278077 GGCCGCCTGCGCCTCCGTGTGGG - Exonic
1161267283 19:3370132-3370154 GGCCTGCAGCCCCTCAGTGCCGG + Intronic
1161585188 19:5101980-5102002 GGCCGCCTGCCCCTCCTCGCTGG - Intronic
1161594208 19:5142911-5142933 GGCCGCCAGGGCCCCGGTGCTGG + Intronic
1162329869 19:10021246-10021268 GGTCGCCAGCATCTCCCTGGTGG + Exonic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1162769085 19:12938331-12938353 GGCCGCGAGCACCTCAGGCCAGG - Intergenic
1162953708 19:14086870-14086892 GGCAGACAGCATCTCTGTGCCGG + Intergenic
1163442595 19:17329270-17329292 AGCCGCCTGCACCTGCTTGCTGG + Intronic
1165108298 19:33487194-33487216 GGCTGCCAGCACTTTTGTGCCGG - Intronic
1165803267 19:38565672-38565694 GACCGCCAGCCCCTTCGGGCCGG - Exonic
1165933734 19:39376562-39376584 TGCCCCCAGCACCTCCCTGATGG - Intronic
1166046936 19:40235363-40235385 GGCCGTCAGCACCTGCCTCCCGG + Intronic
1166294575 19:41882914-41882936 GCCCCCCAGCACCTCCGGGGAGG + Intergenic
1166774173 19:45302545-45302567 GCCCGCCCGCACCCCCGTGCAGG - Exonic
1167149629 19:47701476-47701498 AGCCGCCTGCCCCGCCGTGCCGG - Exonic
1168092563 19:54095582-54095604 GGCCCCCAGCCCCTCCTTCCTGG - Exonic
1168122044 19:54256964-54256986 GGGCCCCAGGACCTGCGTGCAGG - Exonic
926206449 2:10837253-10837275 GGACGTCAGCCCCTCCCTGCTGG - Intronic
932541915 2:72664344-72664366 GGCTCTCAGCAACTCCGTGCTGG - Intronic
933166899 2:79086626-79086648 GACCACCAGCATCTCTGTGCTGG + Intronic
935518867 2:104078815-104078837 GGCCTCCAGCACCACAGAGCAGG - Intergenic
937875362 2:126821127-126821149 GGCCTCCAGCTCCTCCCTCCTGG - Intergenic
939776366 2:146392570-146392592 CGCCCCCACCACCTCCATGCTGG + Intergenic
1170889005 20:20363898-20363920 GGCCGCCAGCACCTCACAGGTGG + Intergenic
1171361620 20:24590273-24590295 GGCCCCCAGCCCCGCCGCGCCGG - Intronic
1174078235 20:47952951-47952973 TGCAGCCAGCACCTCTGGGCTGG - Intergenic
1176301000 21:5099079-5099101 GGCCGCAAGCACATCTGTGTGGG + Intergenic
1179142442 21:38738051-38738073 ACCCGCCAGCACCTCCGTCTTGG - Intergenic
1179707995 21:43193682-43193704 GGCCGCCACCACCACGCTGCTGG + Intergenic
1179984111 21:44911796-44911818 GGCCGGCAGCACCTCCTAGCGGG + Intronic
1179991551 21:44950788-44950810 AGCCTCCTGCACCTCCTTGCCGG + Intronic
1180459984 22:15553859-15553881 GGCCGCTGGCACGTCCGGGCCGG + Intergenic
1181671521 22:24427676-24427698 GGCCCCCAGCACCTTGGTGCGGG + Intronic
1183466582 22:37983263-37983285 GGCCTCCTGCACCTCAGAGCGGG - Intronic
1183702306 22:39457467-39457489 GGACGCCAGCATCTCCCCGCCGG + Exonic
1184136573 22:42553647-42553669 GGCCGCCCCCACGTCCGCGCGGG - Intronic
1185139232 22:49091002-49091024 GGCCGCCTGCACCTGTCTGCTGG - Intergenic
949545519 3:5069032-5069054 GGGCCCCAGGCCCTCCGTGCAGG + Intergenic
952286799 3:31977316-31977338 GGCCGCCAGCATCTCTTTCCTGG + Intronic
952418987 3:33114478-33114500 GTCCGCCAGCACCTCGCGGCTGG - Exonic
956487594 3:69739404-69739426 GGCCGCCAGCCCCTCCCGCCCGG + Intergenic
964887663 3:161503162-161503184 TGGCGCCAGGCCCTCCGTGCAGG - Exonic
965735007 3:171810413-171810435 GGCCGCTAGCACCTGCGCGTTGG + Exonic
966146174 3:176814398-176814420 GGCCGGCAGCCCCTCTGTGCTGG + Intergenic
966454488 3:180099710-180099732 GGCCTCCAAAAGCTCCGTGCGGG - Intergenic
968425971 4:523539-523561 GGGCGCCAGCAGCTTCGTGGAGG + Exonic
968641540 4:1717417-1717439 GGCCTCCAGCTCCTGCGGGCAGG + Exonic
968662284 4:1803642-1803664 GAGCGCCAGCACCGCCCTGCGGG - Intronic
968891681 4:3372597-3372619 GGCCGCCGCCACCTCCATGCCGG - Intronic
968899335 4:3423571-3423593 GGGCCGCAGCACCTCCGTGACGG - Exonic
970332943 4:15003495-15003517 GGCTGCCCGCGCCTCCGTGGCGG - Exonic
975983585 4:80184239-80184261 GGGCGCCAGCACCCCGGGGCCGG + Intronic
981540730 4:145843918-145843940 TGCCCCCATCACCTCCTTGCAGG + Intronic
985112015 4:186555595-186555617 GGCCGACAGCGCCCCGGTGCGGG + Intergenic
985451653 4:190066453-190066475 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985452640 4:190069744-190069766 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985453626 4:190073041-190073063 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985454616 4:190076334-190076356 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985455604 4:190079627-190079649 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985456588 4:190082921-190082943 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985457576 4:190086221-190086243 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985458563 4:190089514-190089536 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985459552 4:190092814-190092836 CGCCGCCAGGCGCTCCGTGCTGG - Intergenic
985463803 4:190175583-190175605 GACCGCCAGGCGCTCCGTGCTGG - Intronic
985570789 5:643692-643714 AGCCGCCAGCACCTGCGGCCAGG - Intronic
993385055 5:87252634-87252656 GGCTGCCATCACTTCCATGCCGG + Intergenic
1007710006 6:43816845-43816867 GGCTGCAAGAACCTCCTTGCTGG - Intergenic
1012511603 6:100009132-100009154 CACCCCCAGCACATCCGTGCTGG + Intergenic
1017086489 6:150717539-150717561 GGCCACCTGCACCTCCTTGCTGG + Intronic
1017690318 6:156957473-156957495 GGCTGCCAGGACCACCGTGCAGG + Intronic
1017891581 6:158644194-158644216 CGCCGCCAGCCCCTCCGCCCCGG - Intronic
1018909979 6:168096323-168096345 GGCCGCCTGCACCTCTAAGCAGG + Intergenic
1022192147 7:28026803-28026825 GGGAGCCAGCACCTCCTTACTGG + Intronic
1026000361 7:66556293-66556315 GCACGGCAGCCCCTCCGTGCTGG - Intergenic
1029714492 7:102318583-102318605 GGCCGCCAGGAAATCCGTCCTGG - Intronic
1029732311 7:102446583-102446605 GGCCACCAGCACCGTGGTGCAGG - Exonic
1033246016 7:139716818-139716840 AACCGTCAGCACCTCCTTGCCGG - Exonic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1035291783 7:157844011-157844033 CGCCGCCCCCTCCTCCGTGCAGG - Intronic
1045459275 8:102412371-102412393 GGCCGCCGCCGCCTCCCTGCCGG + Exonic
1048391892 8:133974718-133974740 AGCCGCCATCACCTCTGTCCTGG + Intergenic
1049744466 8:144257399-144257421 GGCCCCCAGCACCTCCTTCCTGG + Intronic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1060985108 9:127815290-127815312 GGCCAACAGCACCTCCCCGCTGG - Exonic
1061415666 9:130445576-130445598 GGCCGCCAGCCCCACCGGGGAGG - Intronic
1062144681 9:134982506-134982528 CGCAGCCAGCACCCTCGTGCTGG + Intergenic
1062488302 9:136791863-136791885 GGCCCCCAGCACCTGCGGGCAGG - Intronic
1062547525 9:137070383-137070405 GCGCGGCAGCCCCTCCGTGCTGG + Exonic
1203791544 EBV:154300-154322 GGCCGCCAGCAGCTTCTTGATGG + Intergenic
1185880402 X:3735162-3735184 GGCCTCCAGCAACTCCATGGAGG - Intergenic
1188648022 X:32593146-32593168 GGCCGGCAGCACCTCTGTCTGGG - Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1192612466 X:72581037-72581059 GGCAGCCGCCACCTACGTGCAGG - Exonic
1192988825 X:76428584-76428606 GGGCCTGAGCACCTCCGTGCAGG + Exonic
1192988855 X:76428692-76428714 GGGACCGAGCACCTCCGTGCCGG + Exonic
1194173467 X:90617899-90617921 GGCCTCAACCACCTCCCTGCAGG - Intergenic
1195410795 X:104566465-104566487 TGCCGCCTGCACCTCCGTTAGGG + Exonic
1200785385 Y:7256151-7256173 GGCCTCCAGCAACTCCATGGAGG + Intergenic
1202369883 Y:24189264-24189286 GGCCGCCAATGCCTCCCTGCTGG - Intergenic
1202500901 Y:25480853-25480875 GGCCGCCAATGCCTCCCTGCTGG + Intergenic