ID: 1134037151

View in Genome Browser
Species Human (GRCh38)
Location 16:11039901-11039923
Sequence CCTACAACTGCGTGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134037151_1134037161 16 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037161 16:11039940-11039962 GAGCCTGAGCCCTGGGTGCTAGG 0: 1
1: 0
2: 8
3: 46
4: 488
1134037151_1134037158 8 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037158 16:11039932-11039954 CCCACTGGGAGCCTGAGCCCTGG 0: 1
1: 0
2: 4
3: 59
4: 415
1134037151_1134037160 9 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037160 16:11039933-11039955 CCACTGGGAGCCTGAGCCCTGGG 0: 1
1: 1
2: 5
3: 36
4: 336
1134037151_1134037154 -7 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037154 16:11039917-11039939 TTGTAGGAAGCAGACCCCACTGG 0: 1
1: 0
2: 1
3: 13
4: 128
1134037151_1134037155 -6 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037155 16:11039918-11039940 TGTAGGAAGCAGACCCCACTGGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134037151 Original CRISPR CCTACAACTGCGTGGCCCTG TGG (reversed) Intronic