ID: 1134037153

View in Genome Browser
Species Human (GRCh38)
Location 16:11039909-11039931
Sequence GTCTGCTTCCTACAACTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134037153_1134037160 1 Left 1134037153 16:11039909-11039931 CCACGCAGTTGTAGGAAGCAGAC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134037160 16:11039933-11039955 CCACTGGGAGCCTGAGCCCTGGG 0: 1
1: 1
2: 5
3: 36
4: 336
1134037153_1134037161 8 Left 1134037153 16:11039909-11039931 CCACGCAGTTGTAGGAAGCAGAC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134037161 16:11039940-11039962 GAGCCTGAGCCCTGGGTGCTAGG 0: 1
1: 0
2: 8
3: 46
4: 488
1134037153_1134037165 30 Left 1134037153 16:11039909-11039931 CCACGCAGTTGTAGGAAGCAGAC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134037165 16:11039962-11039984 GCCTGAGCCTTCTGAGAATCCGG 0: 1
1: 2
2: 114
3: 6247
4: 108564
1134037153_1134037158 0 Left 1134037153 16:11039909-11039931 CCACGCAGTTGTAGGAAGCAGAC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134037158 16:11039932-11039954 CCCACTGGGAGCCTGAGCCCTGG 0: 1
1: 0
2: 4
3: 59
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134037153 Original CRISPR GTCTGCTTCCTACAACTGCG TGG (reversed) Intronic