ID: 1134037161

View in Genome Browser
Species Human (GRCh38)
Location 16:11039940-11039962
Sequence GAGCCTGAGCCCTGGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 488}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134037153_1134037161 8 Left 1134037153 16:11039909-11039931 CCACGCAGTTGTAGGAAGCAGAC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134037161 16:11039940-11039962 GAGCCTGAGCCCTGGGTGCTAGG 0: 1
1: 0
2: 8
3: 46
4: 488
1134037151_1134037161 16 Left 1134037151 16:11039901-11039923 CCACAGGGCCACGCAGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1134037161 16:11039940-11039962 GAGCCTGAGCCCTGGGTGCTAGG 0: 1
1: 0
2: 8
3: 46
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134037161 Original CRISPR GAGCCTGAGCCCTGGGTGCT AGG Intronic