ID: 1134038103

View in Genome Browser
Species Human (GRCh38)
Location 16:11047463-11047485
Sequence ATGGGGAAGCAGATTTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134038095_1134038103 28 Left 1134038095 16:11047412-11047434 CCCAGAGGGAGTTTTTTGACTTA 0: 1
1: 0
2: 2
3: 19
4: 273
Right 1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG 0: 1
1: 0
2: 6
3: 39
4: 412
1134038096_1134038103 27 Left 1134038096 16:11047413-11047435 CCAGAGGGAGTTTTTTGACTTAG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG 0: 1
1: 0
2: 6
3: 39
4: 412
1134038101_1134038103 -6 Left 1134038101 16:11047446-11047468 CCAAATAGCACAGATTGATGGGG 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG 0: 1
1: 0
2: 6
3: 39
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134038103 Original CRISPR ATGGGGAAGCAGATTTAGAA TGG Intronic
901279223 1:8019654-8019676 GGGGAGAAGCAGATTTATAAAGG + Intronic
901748833 1:11393371-11393393 ATGGTGGAGCAGACATAGAAAGG + Intergenic
903059245 1:20658154-20658176 ATGGGGAAGTGGGTTCAGAAGGG - Intronic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
904759911 1:32795480-32795502 ATGGGCAAACTGTTTTAGAAAGG + Intronic
905172583 1:36118013-36118035 ATGGGGAAGCAGCTTTAGGTAGG - Intronic
905649094 1:39644674-39644696 TTGCGGAAGCAGGTTTAAAAAGG + Intergenic
906141233 1:43534875-43534897 ATGAGGAAGCGGATTCAGAGAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906782197 1:48582732-48582754 ATCGGGAAACAGATTCAGAGTGG + Intronic
907879311 1:58530375-58530397 ATGGGTATGGAGAGTTAGAAGGG - Intronic
908114378 1:60926490-60926512 ATGAGGAAGAAACTTTAGAATGG - Intronic
908998363 1:70186641-70186663 ATGGGAAAGGAGATTTAAAGAGG - Intronic
910486114 1:87716066-87716088 AAGTGGAAGCAGTTTTATAAAGG + Intergenic
910990088 1:93047021-93047043 ATGGGGTAGAATATTTAGATGGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911907112 1:103584150-103584172 ATGTGGAAGCTGATTGATAATGG - Intergenic
911973774 1:104466502-104466524 ATAGGGAAGCACTCTTAGAAGGG - Intergenic
912029835 1:105227105-105227127 ATGTGGAAGCAACTTTGGAACGG + Intergenic
912088560 1:106041250-106041272 ATGGGGTAGTAAATTTAGAAGGG + Intergenic
912708148 1:111930078-111930100 TTAGGTAGGCAGATTTAGAAGGG + Intronic
913571199 1:120121820-120121842 ATGGGGAAACAGATTTAATCTGG + Intergenic
914292008 1:146282797-146282819 ATGGGGAAACAGATTTAATTTGG + Intergenic
914553052 1:148733580-148733602 ATGGGGAAACAGATTTAATTTGG + Intergenic
914922885 1:151859513-151859535 CTGGGGCAGCAGATCTAGACAGG - Intergenic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
916153658 1:161822450-161822472 CTTGGAAAGCAGATTTAGTAGGG + Intronic
916404453 1:164484099-164484121 TTGGAGAAGCATATTTAAAAAGG - Intergenic
917195744 1:172463672-172463694 ATGGGGCAACAAATTTCGAAAGG - Intronic
917803764 1:178595182-178595204 ATGAGGAAGTAGGTTTAAAAAGG - Intergenic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
921167423 1:212517053-212517075 AGGGGGAAGCAGTTTTTGTAGGG - Intergenic
921397591 1:214685071-214685093 CCGGGGAAGCAGCTTTACAATGG - Intergenic
921480703 1:215661663-215661685 ATAAGGATGGAGATTTAGAAAGG + Intronic
921747360 1:218753390-218753412 ATAGGGAAGCACTCTTAGAAGGG - Intergenic
922089245 1:222379838-222379860 GTGGGGAAGCAAATTTACCATGG - Intergenic
923406126 1:233662630-233662652 ATGGGAAGGCAAATTTAGTAGGG + Intronic
924416584 1:243861965-243861987 ATTGGGATCCAGATTTACAAGGG + Intergenic
924802674 1:247338844-247338866 ATGGGGAAGTAGACTTTGTACGG + Intergenic
924937758 1:248786602-248786624 ATGAGGAAACAGATTTGCAAAGG - Intergenic
1063135335 10:3211607-3211629 ATGGGGAAACAGATTTGAAATGG - Intergenic
1063303876 10:4878587-4878609 ATGGGGAAAGGGATTTGGAAAGG + Intergenic
1063973698 10:11398556-11398578 ATGAGGAAGCATTTCTAGAAGGG - Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065187902 10:23187245-23187267 AGGTGGAAACAGATTTAGAAAGG - Intergenic
1065498264 10:26352278-26352300 AAGGAGAAGCATTTTTAGAAAGG + Intergenic
1065712233 10:28529733-28529755 ATGTGGAAGCAGGCATAGAAGGG + Intergenic
1066546012 10:36501491-36501513 ATGAAGAAGCAGATATATAAGGG - Intergenic
1066638662 10:37533540-37533562 ATTGGGAACCAGATTTAAAAAGG + Intergenic
1067450838 10:46380962-46380984 ATGGGGAGGCAGATTTCCTAAGG + Intronic
1067586405 10:47478789-47478811 ATGGGGAGGCAGATTTCCTAAGG - Intronic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1068097434 10:52509829-52509851 ATGGGGAAACATATTTCTAAAGG - Intergenic
1068874217 10:61979610-61979632 CTGGGGAAGGACATTTGGAAGGG - Intronic
1068907849 10:62346522-62346544 ATGGAGAAGCAGATTTTCATAGG - Intergenic
1069225953 10:65944371-65944393 GTGGAGAAGCAGATGTATAATGG + Intronic
1070227325 10:74523375-74523397 ATGGGGAAGTAGAGAAAGAAAGG - Intronic
1071074208 10:81732023-81732045 ATGAGCCAACAGATTTAGAAAGG + Intergenic
1071273513 10:84030808-84030830 ATGGGAAAGCAGATCTTGTAGGG + Intergenic
1072218281 10:93306300-93306322 ATTGGGCAGCATATTTATAAAGG + Intergenic
1072458364 10:95597033-95597055 ATGGTGGGGCAGGTTTAGAAGGG + Intergenic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1074296673 10:112195570-112195592 ATGGGGAAGAAACTTAAGAAAGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1075119864 10:119656892-119656914 ATGGGACAGCAGATTTGGAGAGG + Intronic
1077616033 11:3674646-3674668 AAAGGGAATCTGATTTAGAAAGG + Intronic
1079074493 11:17375548-17375570 ATGGGCAAGGAGAACTAGAAAGG - Exonic
1079534380 11:21493605-21493627 GATGGGAAGCAGATTAAGAAAGG + Intronic
1080143451 11:28950530-28950552 ATAGGCAAGCAAACTTAGAAAGG + Intergenic
1080269054 11:30431390-30431412 ATTGGGAAACAGATTCAGAGAGG - Intronic
1080934901 11:36852850-36852872 ATGGGATAGCAGATTTGAAATGG - Intergenic
1081226209 11:40525738-40525760 ATTGGGAAGCTGATTTTAAAAGG + Intronic
1083336566 11:61925148-61925170 ATGAGGAAACAGATTTGGAAAGG + Intergenic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1085363908 11:75919767-75919789 ATGAGGAAGCAGTCTTAAAATGG + Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085822995 11:79813028-79813050 CTGGGGAAACAGATATAAAATGG + Intergenic
1085844829 11:80053068-80053090 AAGGGGAAGCAAAATCAGAATGG + Intergenic
1086573961 11:88316862-88316884 ATAGGGAAGCAGCTTTGGAGAGG - Intronic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087728948 11:101756967-101756989 ATGGAGAAGTGAATTTAGAAAGG + Intronic
1088138699 11:106589728-106589750 AAGTCGCAGCAGATTTAGAAGGG - Intergenic
1089309626 11:117549105-117549127 ATGGGGAAACACATGTAGGAAGG - Intronic
1089813087 11:121147693-121147715 ATGGGGAAGCTGTTTTGGAAGGG + Intronic
1090241635 11:125187062-125187084 ATGGGGATGGACATTTAGACTGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093842737 12:23924405-23924427 ATGGGAAGCCAGATTTACAAAGG + Intronic
1093927305 12:24921795-24921817 AGCAGGAAGCAGATTTAGAAAGG - Intronic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094179824 12:27580408-27580430 ATGTGGAAGCTGATCCAGAAAGG - Intronic
1094216957 12:27952544-27952566 AGGCGAAAGCAGATTTAAAATGG - Intergenic
1094423674 12:30297652-30297674 ATGGGGAAGAAGAGAAAGAAGGG - Intergenic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097018131 12:56001635-56001657 ATGAGGAAGCAAGTTCAGAACGG + Exonic
1098276479 12:68817179-68817201 ATGGGGAAGCAGGTTTAAAAAGG - Intronic
1099088531 12:78277584-78277606 ATGTGGAAGCAACTTTGGAACGG + Intergenic
1099854494 12:88146277-88146299 ATGGGGAAGAAGTTATAAAAGGG - Intronic
1100682777 12:96947332-96947354 CTGTGGGGGCAGATTTAGAAAGG + Intronic
1101363966 12:104054471-104054493 ATGGGGAGGCAGATATCCAAAGG + Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101668517 12:106843848-106843870 ATAGGGAAGCAGCTATAGAGAGG + Exonic
1101722589 12:107363018-107363040 ACGGGGAGGCAGCTTTATAATGG - Intronic
1102564187 12:113784026-113784048 ATGAGGAAGCAGATTCAGAGAGG - Intergenic
1102710207 12:114919309-114919331 ATGGGGAAGCAGATTCAGAGAGG - Intergenic
1104117494 12:125763924-125763946 ATGGGCAAGGAGTTTTAGTATGG - Intergenic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105447522 13:20470537-20470559 AAGGGGAAGCAGATTTTGAATGG + Intronic
1106831283 13:33585960-33585982 ATGGGGATGAAGTTTTAGTATGG + Intergenic
1107887741 13:44888360-44888382 ATGGAAAAGTAGATTTAGAAAGG + Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1109211851 13:59544438-59544460 ATGGGGAACTTGATATAGAATGG + Intergenic
1109390085 13:61681930-61681952 ATGTGGAAGTAACTTTAGAACGG + Intergenic
1110229883 13:73156946-73156968 ATGGCTAGGTAGATTTAGAATGG + Intergenic
1110399791 13:75076585-75076607 CTGAGGAAGCAGAGCTAGAAGGG + Intergenic
1110597484 13:77335270-77335292 ATTGGGAAACAGATGTAGACTGG - Intergenic
1111608976 13:90578755-90578777 ATGTGGAAGAAGCTTTGGAATGG - Intergenic
1111697459 13:91642670-91642692 AAGGGGAAGAGGACTTAGAAAGG + Intronic
1112630892 13:101160282-101160304 AGAGGGAAGGAAATTTAGAAGGG - Intronic
1114219378 14:20683097-20683119 AGGGGAATCCAGATTTAGAAAGG + Intergenic
1114222610 14:20710340-20710362 ATCGGGAAACAGATTTAAAATGG - Intergenic
1114318761 14:21529355-21529377 ATGGGACACTAGATTTAGAAGGG - Intronic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114690487 14:24575560-24575582 ATGGGGCAGCAGATTGGGAGGGG + Intronic
1115114208 14:29859944-29859966 ATGAGTAAACAGATTTTGAATGG + Intronic
1115224011 14:31085120-31085142 CTGGCGAAGCAGACATAGAATGG - Exonic
1115428420 14:33288109-33288131 AAGAGGAAACTGATTTAGAAAGG + Intronic
1115498870 14:34031934-34031956 ATGAGGAAGTAGCTTTAGCAAGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115733516 14:36297699-36297721 GTGGGGAAGCAGAGATAAAAAGG + Intergenic
1115878677 14:37891098-37891120 ATGTGGAAGCAACTTTGGAACGG + Intronic
1116737260 14:48707809-48707831 ATAGGGACGCAGACTTGGAAAGG - Intergenic
1117278149 14:54210236-54210258 AAGGTGAAACAGATCTAGAAAGG - Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117997772 14:61494032-61494054 AAGAGGAAGAAGTTTTAGAAAGG + Intronic
1118320980 14:64753276-64753298 ATGGGGAAACCGATTTAAAGAGG + Intronic
1119010056 14:70976247-70976269 ATGAGGAAACAGATTTACAGGGG + Intronic
1119070269 14:71576206-71576228 AAAGGGAAGCATTTTTAGAAAGG + Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1120379512 14:83757293-83757315 ATGGTGAAGCTGATATGGAAGGG - Intergenic
1121498954 14:94418326-94418348 ATGTGGAAGCAACTTTGGAATGG + Intergenic
1121723657 14:96130338-96130360 ATGGGGAACCAGATTCAGAATGG + Intergenic
1122308571 14:100780612-100780634 ATGGGGACCCAGCTTTATAAAGG + Intergenic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1124907568 15:33885703-33885725 ATGGGGAAGCAGCTTTTTAATGG - Intronic
1126015493 15:44346713-44346735 ATGGGGAAGAAGATTAGGACAGG + Intronic
1126639409 15:50809913-50809935 ATGGGTAAACAGATTTAAAGAGG + Intergenic
1126767310 15:52022005-52022027 AGGGGGAAAAAGATTGAGAATGG + Intronic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1126873350 15:53012184-53012206 ATGTGGAAGCAACTTTGGAATGG - Intergenic
1127742906 15:61930864-61930886 ATGGAGTAACATATTTAGAATGG - Intronic
1128483096 15:68055969-68055991 AAGGGAGAGCAGATTTACAATGG + Intronic
1128869573 15:71143492-71143514 AAGGGCAAGCAGATTATGAAAGG + Intronic
1129648320 15:77459521-77459543 TTGGGGATGCAGTTTTAGACAGG + Intronic
1129813033 15:78526067-78526089 ATGGGGAAACAGATTCATAGAGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134221800 16:12360779-12360801 AAGAGGAAGCATATTTAGGAAGG + Intronic
1135621647 16:23960948-23960970 ATGGGGAAGAATTTTAAGAAGGG - Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1139837265 16:69849203-69849225 ATTGGGAAGCAGAGCTAGCAGGG + Intronic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1141019419 16:80480932-80480954 ATGGGCAAGCAGTTTCAGGAGGG + Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1142607345 17:1089409-1089431 ATGAGGAAGCTGATTCAGAGCGG + Intronic
1145095941 17:20026473-20026495 ATGGGGTCACAGAATTAGAAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1147945066 17:44076151-44076173 GTGCGGAAGCAGATTTAGGGAGG - Exonic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151325508 17:73377525-73377547 TAGGGGAAGTAGATTTAAAAAGG - Intronic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1156047754 18:32896684-32896706 ATGTGGAAGCAGCTTTGAAATGG + Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157111507 18:44824819-44824841 CTAGGGAAGCAGATGAAGAAAGG + Intronic
1158381860 18:56940713-56940735 ATGAGGAAGCAGTTTTATTAGGG + Intronic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1159914418 18:74175949-74175971 AGGTGGAAGCAGGTGTAGAAAGG + Intergenic
1160116801 18:76086043-76086065 AGAGGTAAGCAGAATTAGAAGGG - Intergenic
1160456093 18:79001754-79001776 ATGGGAAAGCAGATTTTACATGG - Intronic
1161290894 19:3492764-3492786 ATGGGGAAGCAGCGGTGGAAAGG + Intronic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166239282 19:41478794-41478816 ATCGGGAAGCAGAGTGACAATGG - Intergenic
1166386621 19:42385823-42385845 AGGGGGAATCAGGTTCAGAAAGG + Intergenic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167868466 19:52347295-52347317 ATGGGGAAAAAGATTTTAAATGG + Intronic
925990578 2:9251151-9251173 ATCGCGAAGGAGATTTTGAAAGG + Intronic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926587358 2:14701868-14701890 ATGAGGAATCAGATTTGGAGAGG - Intergenic
926811837 2:16761970-16761992 TTGGGGAAGGAGATGAAGAAAGG + Intergenic
926858221 2:17280589-17280611 AGGGGGAAGTAGAATAAGAAGGG - Intergenic
927920249 2:26966811-26966833 AAGGTGAAGCAGATAAAGAAGGG + Intergenic
927927744 2:27025252-27025274 TTGGGGAAGTAGAGTTGGAAGGG - Intronic
928327376 2:30330194-30330216 ATGGGGAAGCTGAATCACAAAGG - Intergenic
929300659 2:40300319-40300341 ATGAGAAAGCAGATCTAGACAGG + Intronic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
930445497 2:51466156-51466178 ATGGTGCAGCAGATTTAGTGTGG - Intergenic
930555309 2:52887906-52887928 TTGGGAGAGTAGATTTAGAAGGG - Intergenic
930956610 2:57210502-57210524 ATGGGGAAAGAGCCTTAGAATGG - Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931229852 2:60364991-60365013 ATGGCGAAGGAGGTTTAGAGGGG + Intergenic
931942847 2:67272023-67272045 ATGGGGAGGGAGCTTTGGAATGG - Intergenic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
933160472 2:79018281-79018303 ATGGGGACATAGGTTTAGAATGG - Intergenic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
933766740 2:85714376-85714398 ATGGGGAAATAGATCTAGAGAGG + Intergenic
934155643 2:89197387-89197409 ATGGGGAGGCAGTTATTGAATGG - Intergenic
934211681 2:89985372-89985394 ATGGGGAGGCAGTTATTGAATGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
936802367 2:116284444-116284466 AATGGGAACCAGATTTTGAAGGG + Intergenic
937649118 2:124300077-124300099 ATGTGAAAGCAGTTTTACAAAGG - Intronic
938922150 2:136004852-136004874 AAGGGAAAGCAGCTTTAGACTGG - Intergenic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939588119 2:144030220-144030242 TTGGGAAAGAAGATTTAGATGGG - Intronic
939760736 2:146174685-146174707 TTGGGGAAGCAGAATTTAAAAGG - Intergenic
940357887 2:152765565-152765587 GTGGGGCAGCAGAGATAGAAAGG + Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
944074030 2:195706763-195706785 ATGGGGCAGTAGATGAAGAAGGG - Exonic
944496672 2:200314093-200314115 CTGGAGATGCAGATTTACAATGG - Intronic
944689938 2:202149638-202149660 ATGGGGAACCCCAATTAGAAAGG + Intronic
945639142 2:212400246-212400268 GTGGGGAAGAGGATTTGGAAGGG + Intronic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
947292784 2:228596122-228596144 AATGAGAAGCAGTTTTAGAAGGG + Intergenic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
948348741 2:237321091-237321113 ATGGGGAAAGAAATTTAAAATGG + Intergenic
1168802896 20:654613-654635 ATGAGGAAGATGTTTTAGAAGGG - Intronic
1169459889 20:5785350-5785372 ATGAGGAAACAGTTTTAGAGAGG + Intronic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170363465 20:15573717-15573739 ATAGGGAAGGAGATTCAGAAGGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171507393 20:25648766-25648788 AGGAGGAAGCAGATTTAGAGAGG + Intergenic
1172384226 20:34522262-34522284 ATGGGGAAACAGGTTTGGAAAGG - Intronic
1173455057 20:43195244-43195266 ATGGGGAAACACATTTGGAGAGG - Intergenic
1173730674 20:45326244-45326266 AAGAGGAAGCAGCTTCAGAAAGG + Exonic
1174466907 20:50724849-50724871 GGTGGGAAGCAGATTGAGAAGGG - Intergenic
1175061362 20:56246885-56246907 ATGGGGAATCAGATCTAACATGG + Intergenic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176985422 21:15430910-15430932 ATGGGGAAACACATGTACAAAGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178701818 21:34840365-34840387 GTAGAAAAGCAGATTTAGAATGG - Intronic
1179805835 21:43836300-43836322 ATGGAGAAACAGATTTGGAGGGG - Intergenic
1181018160 22:20083187-20083209 AAGGGGAGGCAGTTTTAGGAAGG - Intronic
1181058777 22:20272177-20272199 ATGAGGAAGCAGATTAATTATGG - Intronic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1184250332 22:43256555-43256577 CTGGGGAAGTTAATTTAGAAAGG + Intronic
1184406222 22:44302486-44302508 ATGGGGGAGCTGCTTTAGAAGGG + Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
950453146 3:13076852-13076874 ACGGGGAATAAGATTTAGGAGGG - Intergenic
951403648 3:22266548-22266570 ATGAGAAAGCACAATTAGAAAGG + Intronic
951494090 3:23306414-23306436 ATGGGGAAGGGGATATAGACTGG - Intronic
951638185 3:24803461-24803483 AAAAGGAAGCAGATTTAGGAGGG - Intergenic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
955052148 3:55423354-55423376 AGGTGGAAGCAGGTTTAGAATGG - Intergenic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
956014111 3:64863070-64863092 ATGGGGATGAATACTTAGAAAGG - Intergenic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
959813718 3:110650675-110650697 AGGGAGAAGGAGATTTTGAAGGG + Intergenic
959860567 3:111210656-111210678 AAGGGGAAACAGTTTTAGATTGG + Intronic
960554551 3:119013055-119013077 ATGGGTAAGCAGAGTTACAGAGG - Intronic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
962129029 3:132652723-132652745 TTGGGGAAGCAGGTCAAGAAAGG + Intronic
962298868 3:134219170-134219192 AAGGGGAAGCAGTGTTAGCATGG - Intronic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
963641601 3:147867164-147867186 TTAGGGAGGCAGATTAAGAAGGG - Intergenic
964090453 3:152870038-152870060 ATAGGGAAGTAGGTTGAGAAGGG - Intergenic
964447364 3:156773978-156774000 ATGAGGAAACAGGTCTAGAAAGG + Intergenic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
965460646 3:168957870-168957892 ATGGTAAAGCAGTTTTTGAAGGG - Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
967466156 3:189808305-189808327 ATGGACCAGCAGATTCAGAACGG + Exonic
967567291 3:190987597-190987619 ATGTGAAAGCAGTTTTGGAACGG + Intergenic
967619534 3:191616204-191616226 ATGGAGAAGCAGATTTCCTAAGG - Intergenic
970207292 4:13667716-13667738 ATATGGAAGCAGATTTGAAATGG - Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971311786 4:25531414-25531436 ATGGGGCAGCTGATTTACAAGGG - Intergenic
971423073 4:26491483-26491505 CTGGGGCTGCTGATTTAGAAGGG + Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
974782259 4:66567863-66567885 AAGTGGAATCAGATGTAGAATGG + Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975273539 4:72466908-72466930 TTGAGGAGGCAGATTTAGAGAGG - Intronic
975311900 4:72912882-72912904 ATGTGGAAGCAACTTTGGAAAGG + Intergenic
975535931 4:75450405-75450427 ATGGGGAAGCAGGGGTAGAACGG + Intergenic
976259994 4:83136334-83136356 ATGTGGAAGCAACTTTGGAATGG - Intronic
976511393 4:85913479-85913501 ATGGTGAAGAAAATTTAGTAAGG - Intronic
976927201 4:90514058-90514080 ATGGAGAAGAACATTTACAAAGG + Intronic
977051687 4:92136186-92136208 GTGGGGAAGGGGATGTAGAAAGG + Intergenic
978425924 4:108582249-108582271 AAAGGGAAGCAAATTTAAAACGG + Intergenic
978540546 4:109812383-109812405 ATGTGGAAGGAGATTTATATGGG - Intergenic
979224410 4:118267617-118267639 ATGAGGAAACAGGTTTGGAATGG + Intergenic
980577374 4:134701623-134701645 ATAGGGAAGACAATTTAGAAAGG - Intergenic
980762900 4:137260303-137260325 ATGGGGCAGGAGATCAAGAAAGG - Intergenic
981068167 4:140507245-140507267 AGGGAGAAACAGATTTAAAAAGG - Intergenic
982678538 4:158403208-158403230 ATGGGGCAGCAGGTTGAGCAGGG + Intronic
983350405 4:166579780-166579802 ATGGGTCAGCAGAAATAGAAAGG + Intergenic
983350442 4:166580876-166580898 ATGGGTCAGCAGAAATAGAAAGG - Intergenic
984111911 4:175627400-175627422 ATGAGCAAGGAGATTTAGAAAGG + Intergenic
984203292 4:176754558-176754580 ATGTGGAGTCAGATTCAGAATGG - Intronic
985807597 5:2058637-2058659 ATGTGGAAGCAACTTTGGAACGG - Intergenic
986271218 5:6232714-6232736 AGGGAGGAGCAGATTTGGAATGG + Intergenic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987663424 5:20906209-20906231 ATGTGGAAGCAACTTTGGAACGG - Intergenic
987712763 5:21523849-21523871 ATGTGGGAGTAGAGTTAGAAGGG - Intergenic
988013999 5:25529735-25529757 ATGTGGAAGCAACTTTGGAACGG + Intergenic
988625613 5:32871454-32871476 CTGGGAAAGCAGAGATAGAAAGG + Intergenic
988759258 5:34295978-34296000 ATGTGGAAGCAACTTTGGAACGG + Intergenic
989611611 5:43298964-43298986 ATGGTGAAAGAGCTTTAGAAAGG + Exonic
990595341 5:57307492-57307514 ATGGGGGAGCAGATCTATAAAGG + Intergenic
990630606 5:57664825-57664847 ATGGGGAAAGACATTTTGAAAGG + Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
992954092 5:81890162-81890184 ATGTGGAAGCAACTTTGGAACGG + Intergenic
993146035 5:84095289-84095311 ATGTGGAAGCAACTTTGGAATGG + Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993752966 5:91692878-91692900 ATGTGGAAGCAGCTTTGGAACGG - Intergenic
995744068 5:115385252-115385274 AAGGGGTAGCAGGGTTAGAAAGG + Intergenic
996171421 5:120296366-120296388 ATGAGGAAATAGATTTAGAGAGG - Intergenic
996901094 5:128542363-128542385 ATAGGTAACCAGATCTAGAATGG + Intronic
996994473 5:129678188-129678210 ATGCTGAAGCAGATTATGAAGGG - Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997840235 5:137233026-137233048 ATGGTGATGCAGGTCTAGAAAGG - Intronic
998532875 5:142901686-142901708 ATGAGGAAGCAGGTTCAGAGAGG - Intronic
998774038 5:145578863-145578885 ATGAGTAAACAGAGTTAGAAGGG + Intronic
998985257 5:147749920-147749942 ATGGGGAAACTGGTTTGGAATGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999933211 5:156456162-156456184 ATGGGGAGGTAGCTTTGGAATGG + Intronic
1000839017 5:166193123-166193145 AGGGGAATGCAGATTAAGAATGG + Intergenic
1001022220 5:168192860-168192882 ATGAGGAAGCAGATTGAAACAGG - Intronic
1001258578 5:170205279-170205301 CTGGTGAAGCATCTTTAGAAAGG + Intergenic
1002353278 5:178600937-178600959 AAAGGGAAAAAGATTTAGAATGG - Intergenic
1003730519 6:8817543-8817565 GTAGGGATGCAGATTTAGAGAGG + Intergenic
1005155694 6:22803628-22803650 ATGGGGCAGCAGATTCACTAAGG + Intergenic
1006749518 6:36367815-36367837 CTGGGGAAGCAGACTCAGAGAGG - Intronic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1009003954 6:57758070-57758092 ATGTGGGAGTAGAGTTAGAAGGG + Intergenic
1009329983 6:62406505-62406527 ATGAGGAAAGAGATTAAGAAAGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010555477 6:77274249-77274271 ATGTGGAAGCGACTTTAGAACGG + Intergenic
1011564919 6:88664170-88664192 ATAGGGAAGCACTCTTAGAAGGG + Intronic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012911845 6:105126697-105126719 ATGAGGAAACAAATTTACAAAGG + Intronic
1014148167 6:118022226-118022248 ATCGGGAAGAAAATTTAGACTGG + Intronic
1014311739 6:119812293-119812315 ATGGAAAAGCAGATTTATCATGG - Intergenic
1015560622 6:134511329-134511351 ATGAGGAAGATGAATTAGAATGG - Intergenic
1016230590 6:141799812-141799834 ATGTGGAAGCAACTTTGGAATGG + Intergenic
1017938199 6:159025785-159025807 ATGTGGAAGCAGCTTTGGATGGG - Intergenic
1019369756 7:655497-655519 ATGGGGATGCAGTTTTGGAGGGG - Intronic
1020350793 7:7216326-7216348 ATGGGGGAGCACATTTAAGAAGG - Intronic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1022549600 7:31226570-31226592 ATGTGGAAGCAACTTTGGAACGG + Intergenic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1026856991 7:73761740-73761762 ATGGGGAAACAGACCTGGAAGGG + Intergenic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1030154838 7:106443907-106443929 GAGGGGAAACAGATTTAAAAAGG + Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031141890 7:117951599-117951621 AAGGTGAAGGAGATCTAGAATGG + Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1032294387 7:130622690-130622712 GTGGGGAAGGAAATGTAGAATGG - Intronic
1034282370 7:149863136-149863158 AGGGGGAAGCTGTATTAGAAGGG + Intronic
1034952356 7:155307613-155307635 ATGAGGAAGAACATGTAGAAAGG + Intronic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037895185 8:22647387-22647409 ATGAGGAAGCAGATCCAGAAAGG + Intronic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1039269350 8:35863801-35863823 ATGGGGAAGCAGGTGAAAAATGG - Intergenic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1041411363 8:57560218-57560240 CTGGGGAGGCTGATGTAGAAGGG - Intergenic
1041955556 8:63554941-63554963 ATGTGGAAGCAACTTTGGAAGGG - Intergenic
1042605958 8:70546838-70546860 ATCTGGAAGCAGATCCAGAATGG - Intergenic
1043303456 8:78763431-78763453 ATTTGGAAGTAGATTTAGATTGG + Intronic
1044027526 8:87191888-87191910 ATGCGCTAGGAGATTTAGAAAGG - Intronic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1046069602 8:109234371-109234393 ATGGGGAAGCAGTTTGAAAGAGG - Intergenic
1046405431 8:113766525-113766547 ATTGGGAGGGAGATATAGAAGGG + Intergenic
1046681477 8:117175308-117175330 ATGGTGAAGCATATTAAAAATGG - Intronic
1048420994 8:134278162-134278184 AGTGGGGAGCAGATTTGGAAAGG + Intergenic
1048452954 8:134549966-134549988 AGGGGGAAGCAGATTTTCATGGG + Intronic
1048849102 8:138627662-138627684 ATGGGGAGGCTGGTTTATAATGG - Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1052025139 9:23565865-23565887 ATGGGGAAGAATGATTAGAAGGG + Intergenic
1052260136 9:26505514-26505536 GTGGGGAATCAGATTTTGGAAGG - Intergenic
1052630662 9:31034519-31034541 ATGAGAAAGCAGATTTGAAAGGG - Intergenic
1052721658 9:32178643-32178665 AGGGAGAAGCAGATGTGGAATGG + Intergenic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1056298941 9:85221983-85222005 ATTGGGAAGCAGAGTGAGATTGG - Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058222735 9:102323302-102323324 TTAGGAAAGCAGATATAGAAAGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059343921 9:113615646-113615668 ATGGGGGACCAGAATCAGAAAGG + Intergenic
1059927219 9:119221862-119221884 GTGTGGAAGCAGAGTTTGAAAGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060824896 9:126682344-126682366 ATGGGGCTGCAGCTTTAGAAGGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186623147 X:11263009-11263031 ATGGTGATGCAAATTTAGAGTGG - Intronic
1187122782 X:16425353-16425375 GTAAGGAAGCAGATTCAGAAAGG - Intergenic
1187204854 X:17172080-17172102 ATGAGGAAACAGATATACAAAGG + Intergenic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1187653904 X:21447524-21447546 ATAGGGATACAGATGTAGAAAGG + Intronic
1189214042 X:39308187-39308209 ATGGAAAAGAAGATTTAAAAAGG + Intergenic
1189973716 X:46442333-46442355 ATGGGCAAGCAGATTTCTGAAGG + Intergenic
1191797141 X:65033767-65033789 ATAAGGAAACAGATTTAGACAGG + Intronic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1192326541 X:70137148-70137170 ATGGGGGAGTACATTTAGGAGGG + Intronic
1192696142 X:73417911-73417933 ATGTGAAAGCAGCTTTGGAATGG - Intergenic
1193138589 X:78001090-78001112 ATGGGCAAACAGAAATAGAAGGG - Intronic
1193421201 X:81284351-81284373 ATGGGACAGCAGTTTTGGAAAGG + Intronic
1193629506 X:83865173-83865195 ATGGATGAGCAGGTTTAGAAGGG - Intronic
1193824533 X:86206664-86206686 ATGAGGAAAGAGATTTAGCAAGG - Intronic
1194504761 X:94720272-94720294 ATGGGAAAGTAGATTTAGACAGG - Intergenic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1195479767 X:105330864-105330886 ATGTGGAAGAATGTTTAGAAAGG - Intronic
1196687356 X:118522970-118522992 ATGGGAAAACAGATTAAGAGAGG - Intronic
1197088757 X:122511058-122511080 ATGTGGAAGCAACTTTGGAATGG - Intergenic
1197266853 X:124383536-124383558 AAGAGGAAGCATATTTACAAAGG + Intronic
1197907013 X:131436097-131436119 ATGGAGAAGCAGTTTTTGTAGGG + Intergenic
1198475709 X:136995823-136995845 ATGGGAAAGTAGTTTTAAAATGG + Intergenic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1198949028 X:142048667-142048689 ATGGGAAACTAGGTTTAGAATGG + Intergenic
1202282917 Y:23209016-23209038 ATGTGGAAGCATCTTTGGAACGG + Intergenic
1202434591 Y:24823401-24823423 ATGTGGAAGCATCTTTGGAACGG + Intergenic