ID: 1134038868

View in Genome Browser
Species Human (GRCh38)
Location 16:11052637-11052659
Sequence CAGGCACACGATTCTGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134038854_1134038868 23 Left 1134038854 16:11052591-11052613 CCACCCTGTCCGGCCCACTGACG 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038859_1134038868 9 Left 1134038859 16:11052605-11052627 CCACTGACGCCTTCCTTCCATGT 0: 1
1: 0
2: 1
3: 26
4: 244
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038863_1134038868 -8 Left 1134038863 16:11052622-11052644 CCATGTCCTCCCTGCCAGGCACA 0: 1
1: 0
2: 2
3: 74
4: 501
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038857_1134038868 14 Left 1134038857 16:11052600-11052622 CCGGCCCACTGACGCCTTCCTTC 0: 1
1: 0
2: 2
3: 31
4: 220
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038853_1134038868 24 Left 1134038853 16:11052590-11052612 CCCACCCTGTCCGGCCCACTGAC 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038856_1134038868 19 Left 1134038856 16:11052595-11052617 CCTGTCCGGCCCACTGACGCCTT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038858_1134038868 10 Left 1134038858 16:11052604-11052626 CCCACTGACGCCTTCCTTCCATG 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038855_1134038868 20 Left 1134038855 16:11052594-11052616 CCCTGTCCGGCCCACTGACGCCT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038860_1134038868 0 Left 1134038860 16:11052614-11052636 CCTTCCTTCCATGTCCTCCCTGC 0: 1
1: 0
2: 7
3: 125
4: 1248
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1134038861_1134038868 -4 Left 1134038861 16:11052618-11052640 CCTTCCATGTCCTCCCTGCCAGG 0: 1
1: 0
2: 6
3: 49
4: 490
Right 1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134038868 Original CRISPR CAGGCACACGATTCTGTTTG TGG Intronic
911075835 1:93874026-93874048 CAGGCACACAATTCAGGTTCAGG + Intronic
913203549 1:116515576-116515598 CAGGCACAGGATTCTTGTTGGGG + Intronic
915951511 1:160192623-160192645 CAGCCACACAGTTCTGTTTTTGG - Intronic
920024288 1:202981596-202981618 CAGGCTCACTCTCCTGTTTGGGG - Intergenic
1065439789 10:25739710-25739732 CAGGGACAATATTCTGTATGTGG - Intergenic
1074072043 10:110081548-110081570 GAGGCACACTCTTCTGTATGAGG + Intronic
1079513738 11:21241737-21241759 CAAACACATAATTCTGTTTGGGG - Intronic
1081747498 11:45483309-45483331 CAGGCACAGCTTTGTGTTTGGGG + Intergenic
1083953951 11:65972288-65972310 CTGGGACACGATTCTGTCTCGGG - Intronic
1084873472 11:72113368-72113390 CAGGCACAGCATTCTGTTGCTGG + Intergenic
1084979425 11:72821495-72821517 CAGGGACGCGCTGCTGTTTGTGG - Intronic
1086078740 11:82880925-82880947 TAGGAAGATGATTCTGTTTGTGG - Intronic
1094115568 12:26908642-26908664 CAGGCACAAAATTCACTTTGGGG + Intronic
1096633214 12:52942882-52942904 CTGCCACACGCTTCTGATTGGGG + Intronic
1097729808 12:63115866-63115888 CAGGCACATGACTTTGTTTCTGG - Intergenic
1097952147 12:65443291-65443313 CAGGCATTTGAATCTGTTTGAGG - Intronic
1101262739 12:103049197-103049219 AAGGCACACGATTTTTGTTGTGG - Intergenic
1103178532 12:118886691-118886713 CAGGAACAGGATTATGTGTGGGG + Intergenic
1103762178 12:123258790-123258812 CAAGCACACCTTTCTCTTTGAGG + Intergenic
1129750870 15:78062853-78062875 CAAGCAGATGATACTGTTTGGGG - Intronic
1131946344 15:97626342-97626364 CAAGAAAACTATTCTGTTTGGGG - Intergenic
1133823343 16:9256436-9256458 CAGGCACACGATGGTGCTTAAGG - Intergenic
1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG + Intronic
1146420020 17:32675409-32675431 CAAGCACAAGATTATGTTTCTGG - Intronic
1149097204 17:52857196-52857218 CAGGAAAACTGTTCTGTTTGTGG + Intergenic
1152389942 17:79997819-79997841 CAGTGACACTATTCTGTGTGAGG - Intronic
1160564626 18:79779545-79779567 CAGGCAGATGCTTCCGTTTGGGG - Intergenic
925217843 2:2112492-2112514 CATGCACACGATGCAGTGTGTGG + Intronic
927319521 2:21726321-21726343 CAGGAACTCGGTCCTGTTTGTGG - Intergenic
929443428 2:41984214-41984236 CAGGCAGAAGATTTTATTTGCGG + Intergenic
934721495 2:96580282-96580304 CATGCACACATTTCTGTTGGAGG - Intergenic
938323176 2:130379125-130379147 TAGGCACACTATTCTGTTGCTGG - Intergenic
939894608 2:147776380-147776402 TAGGCACAAGATTTTGTTTTAGG + Intergenic
945866799 2:215185054-215185076 GAGGCACTCGACTCTTTTTGGGG + Intergenic
946031148 2:216706144-216706166 CAGGCACAGTATTATGTTTATGG + Intergenic
946611626 2:221464638-221464660 CATACACATGATTTTGTTTGCGG + Intronic
948301637 2:236912031-236912053 CAGGCAAAAGGTTCTGTCTGTGG - Intergenic
1172783803 20:37452561-37452583 CAGGCACATGCATGTGTTTGGGG + Intergenic
1172994521 20:39060096-39060118 CAGGTACAGGGTTTTGTTTGGGG + Intergenic
1174115818 20:48225756-48225778 CAGGCACAGTACACTGTTTGGGG - Intergenic
1181648640 22:24247106-24247128 CAGGCACAAAACCCTGTTTGTGG + Intergenic
1182255729 22:29036916-29036938 GAGGCAAAAAATTCTGTTTGGGG + Intronic
1184198739 22:42950437-42950459 CAGGCACAGCATTTTGGTTGAGG + Intronic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
950496213 3:13335970-13335992 CCTGCAGACTATTCTGTTTGGGG + Intronic
950610190 3:14121821-14121843 CAGACACTTGATTCTGTATGGGG - Intronic
951157147 3:19369535-19369557 CAGGCTCAAGATACTGTTTTGGG - Intronic
951254639 3:20433876-20433898 CAGGTACTCTATTCTTTTTGTGG + Intergenic
953884367 3:46707120-46707142 CAGGCACACCTATCTGTCTGTGG - Intronic
954274068 3:49531306-49531328 CAGGCACACTGTTCTGGTTCAGG - Exonic
957234536 3:77568773-77568795 CAGGCACAGGATTTCATTTGGGG - Intronic
959302735 3:104623293-104623315 TAGGCACACTGTTCTGTTTGGGG - Intergenic
962912960 3:139871709-139871731 CAGGCACATGATTCCCTATGGGG + Intergenic
965787854 3:172355330-172355352 CAGGCAGTCCATTCTATTTGTGG + Intronic
968675662 4:1877600-1877622 CAGGCACAGCATTCAGTGTGGGG - Intronic
969629516 4:8328180-8328202 GGGGCAGACAATTCTGTTTGTGG - Intergenic
972634322 4:40869911-40869933 CAGTCACCCCATTCTGCTTGTGG + Intronic
973806146 4:54527816-54527838 CAGGTGCGGGATTCTGTTTGAGG - Intergenic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
985268037 4:188168098-188168120 CAGGCACAAGTTCCTGTTTGGGG - Intergenic
991957908 5:72014214-72014236 CAGGCACACACTTCTGTGAGAGG + Intergenic
993463094 5:88209786-88209808 CAAGTACACTATTCTGATTGAGG - Intronic
996695634 5:126391829-126391851 AAGTTACACAATTCTGTTTGTGG + Intronic
999653666 5:153792312-153792334 CAGGCAAATAATCCTGTTTGGGG - Intronic
1000181117 5:158812410-158812432 CAGGCACTCTATTCTCTTGGGGG + Intronic
1004523444 6:16383569-16383591 CACACACACTTTTCTGTTTGTGG + Intronic
1005166607 6:22929348-22929370 CAGGCACAGGATTCCGTGTTGGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006486199 6:34344574-34344596 CAGGCACAGGGTTTTATTTGGGG + Intronic
1010048052 6:71470456-71470478 AAGGCACACTATTCTGGTGGTGG - Intergenic
1012580131 6:100857904-100857926 CAGGCACAGTCTTATGTTTGAGG - Intronic
1021346424 7:19534534-19534556 CAGGCACAAGGATCTTTTTGGGG + Intergenic
1022624993 7:32026044-32026066 CATGCACACGCTTGTGTGTGAGG - Intronic
1024548612 7:50542086-50542108 CAGGCCCACGACACTGTTAGGGG + Intronic
1036981524 8:13474538-13474560 CAGGCACACGATGCAAGTTGTGG - Intronic
1042798768 8:72693880-72693902 AAGGCACAGTATTATGTTTGAGG - Intronic
1047386523 8:124415256-124415278 CAGTCTCACCATCCTGTTTGGGG - Intergenic
1203791141 EBV:152219-152241 CAGGCACACATTTCTGTGGGAGG + Intergenic
1186174309 X:6908932-6908954 CAGGCACAAGAATCTCTTGGAGG - Intergenic
1190797905 X:53760996-53761018 CAGGCACACATTTCTATATGCGG - Intergenic
1190917254 X:54820214-54820236 CAGGCACACATTTCTATATGCGG + Intergenic
1192355944 X:70403935-70403957 CATGCAGAAGATGCTGTTTGAGG + Exonic
1192410332 X:70928116-70928138 CAGTCATTCCATTCTGTTTGGGG - Intronic
1196323052 X:114366717-114366739 CATGTATTCGATTCTGTTTGGGG - Intergenic
1200337310 X:155363849-155363871 GAGAAACCCGATTCTGTTTGAGG + Intergenic
1200349160 X:155477378-155477400 GAGAAACCCGATTCTGTTTGAGG - Intergenic