ID: 1134041329

View in Genome Browser
Species Human (GRCh38)
Location 16:11070768-11070790
Sequence CAGAGCAAAGACTCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 0, 2: 16, 3: 136, 4: 804}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134041329 Original CRISPR CAGAGCAAAGACTCTGAGGT GGG (reversed) Intronic
900173629 1:1282329-1282351 CAGAGCCATGGCTCTGAGGAGGG - Intronic
900237089 1:1598084-1598106 CGGAGCAAAGACACACAGGTGGG + Exonic
900867773 1:5280696-5280718 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
901099403 1:6707839-6707861 CAGGGCAAAGCCTTTGAGGCAGG + Intergenic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901589631 1:10329714-10329736 CAGAGCAAAGACTCTGTCTAGGG + Intronic
902183843 1:14710563-14710585 TAGTGCAAAGGCCCTGAGGTGGG - Intronic
902369225 1:15994877-15994899 CAGAGCCAAGGCCCTGAGGTGGG - Intergenic
902421881 1:16287204-16287226 CAGTGCAAAGACCCAGAGTTGGG - Intronic
902451058 1:16497519-16497541 CAGTGCAAAGGCCCAGAGGTGGG - Intergenic
902501799 1:16915835-16915857 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
902744777 1:18466498-18466520 TCCAGCAAAGGCTCTGAGGTAGG - Intergenic
902907069 1:19566215-19566237 CAGTGCAAAGGCCCTAAGGTAGG + Intergenic
903065720 1:20698190-20698212 CACAGCAAAGAGTCTGAGCCAGG - Intronic
903249581 1:22043092-22043114 AAGAGCAAAGCCTCTGAGCTAGG + Intergenic
903286337 1:22279332-22279354 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
903353022 1:22729585-22729607 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
903731010 1:25495243-25495265 CAGAGCACACAGTCTGAGCTGGG - Intronic
903772532 1:25772883-25772905 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
903926008 1:26831246-26831268 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
904365549 1:30008878-30008900 TAGAGAAGAGACACTGAGGTAGG - Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
904910325 1:33929802-33929824 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
904943546 1:34182218-34182240 AAATGCAAAGACTGTGAGGTGGG + Intronic
904948296 1:34215231-34215253 AAGTGCAAGGGCTCTGAGGTGGG + Intronic
905410219 1:37763564-37763586 CATGGCAAATACTCTAAGGTTGG + Intronic
905535312 1:38716799-38716821 CAGAGCAAAGATTCTTATCTAGG - Intergenic
905791900 1:40794166-40794188 CAGAGCAAAGGCCTTGAGATGGG + Intronic
905907908 1:41631903-41631925 CTGAGCCAAGGCTCAGAGGTAGG - Intronic
906187629 1:43872947-43872969 CAGTGCAAAAGCTCTGAGGTGGG + Intronic
906259382 1:44375181-44375203 GAGAGCACAGACCCTGAGGCAGG + Intergenic
906698229 1:47839196-47839218 CTGAGAATAGACTCTGTGGTGGG - Intronic
906817986 1:48898984-48899006 CAGCGCAATCACTCTGGGGTCGG - Intronic
907266841 1:53267038-53267060 CTGAGCAAAGGCTCTGAGGCAGG - Intronic
907336003 1:53700051-53700073 CAAAGCCAGGACTCTGAGCTGGG + Intronic
907444763 1:54500338-54500360 AAAAGCAAAGCCTCTGAAGTGGG - Intergenic
907708992 1:56860256-56860278 CTGTGCTAAGACTCTGTGGTTGG + Intronic
908189139 1:61683213-61683235 CACTGCAAAGAGTCTGAAGTGGG + Intronic
908794723 1:67819789-67819811 CAGTGCAAAGGCACTGAGCTGGG - Intronic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
909784908 1:79599154-79599176 CAGAGCATAGACTTTAAGGATGG - Intergenic
910268778 1:85369934-85369956 CAGTGCAAAGGCCCTAAGGTGGG + Intronic
911051503 1:93675550-93675572 CAGAGGAAAGCCACTGGGGTGGG + Intronic
911230355 1:95354450-95354472 AAGAGCAAAGGCCCTGAGGTAGG - Intergenic
912096720 1:106153685-106153707 AAGTGCAAAGGCTCAGAGGTTGG - Intergenic
912446582 1:109740918-109740940 CAGAGCAAACACTCCAAGGTGGG - Intronic
912496095 1:110092685-110092707 CAGGACAAAGTCCCTGAGGTGGG - Intergenic
912564530 1:110577040-110577062 AAGTGCAAAGATCCTGAGGTGGG - Intergenic
912574200 1:110649975-110649997 CCGATCATAGATTCTGAGGTGGG + Intergenic
912870283 1:113297994-113298016 AAGTGCAAAGGCTCTGAGGTAGG - Intergenic
913066438 1:115260175-115260197 AAGACCAAAGGCTCTGAAGTTGG + Intergenic
913199355 1:116483647-116483669 CTGAGTGAAGACTCTGAGGCAGG + Intergenic
913257012 1:116962935-116962957 CAGAGCTAAGGCTGGGAGGTAGG + Intronic
914061705 1:144213496-144213518 CAGCCCAAAGACTTTGTGGTGGG - Intergenic
914117445 1:144752873-144752895 CAGCCCAAAGACTTTGTGGTGGG + Intergenic
915457290 1:156049328-156049350 CAGAGCAAAGACTTGGGGGTGGG - Intronic
915770862 1:158421553-158421575 CAGAGGAAAGACTCTGATATAGG - Intergenic
915831813 1:159138299-159138321 AAGAGCAGAGACTCTGATGTGGG - Intronic
915951876 1:160195105-160195127 AAGAGCAAAGACTCAGAGCGTGG + Exonic
915986624 1:160472316-160472338 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
916010812 1:160703840-160703862 CAGAGCAAAGGCCCTGGGGCAGG + Intronic
916170613 1:161998972-161998994 CAGAGAAAAGGCCCTGAGGCAGG + Intronic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
916499096 1:165371193-165371215 AAGTGCAAAGGCACTGAGGTGGG - Intergenic
916504418 1:165415232-165415254 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
916626630 1:166565194-166565216 CCAAGCACAGACTCTGAGGCAGG - Intergenic
916667839 1:166982863-166982885 AAGTGCAAAAGCTCTGAGGTGGG - Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
918308593 1:183269221-183269243 TAGTACAAAGACCCTGAGGTGGG + Intronic
919507495 1:198417524-198417546 AAGAACGAAGACCCTGAGGTGGG - Intergenic
919613331 1:199774031-199774053 AGGAGCAAAGGCTCTGAGGTGGG + Intergenic
920049741 1:203156426-203156448 AAGTGCAAAGCCCCTGAGGTAGG + Intronic
920216670 1:204366006-204366028 AAGCGCCAAGGCTCTGAGGTGGG + Intronic
920277535 1:204818369-204818391 AAAAGCACAGACTCTGAGGCTGG + Intergenic
920308773 1:205035769-205035791 CAGAGCTAAGACTGGGAGGAAGG + Intergenic
920439647 1:205971141-205971163 CAGAGCTGAGCCTCTGAGGTTGG + Intergenic
920659467 1:207902958-207902980 CAGAGCCCTGACTCTGAAGTTGG - Intronic
921364470 1:214360666-214360688 CAGAGCACAGGCTCTGAGTAAGG + Intronic
921696063 1:218212269-218212291 CAGAGCTAAGACTCAAAGTTAGG + Intergenic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
922204129 1:223431894-223431916 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
922507476 1:226134899-226134921 CAGTGCAGAGGCCCTGAGGTAGG - Intergenic
922918919 1:229284031-229284053 AATATCAAAGACTCTGAGGCCGG - Intronic
923214845 1:231839171-231839193 GAGAGCACAGACTCAGAGGTCGG + Intronic
923779778 1:237011901-237011923 CAGAGCGAAGACTGAGAGGAGGG + Intergenic
924331357 1:242943910-242943932 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
924466337 1:244302065-244302087 CAGAGCAAAGAATCTGAGCCTGG - Intergenic
924706799 1:246508878-246508900 CAGAGCCAAGGCCCTGAGGTGGG + Intergenic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063833308 10:9982289-9982311 CACAACAAATACTCTGAGATGGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1065155334 10:22864088-22864110 CAGAGCAGATACTGTGAGGTGGG + Intergenic
1065794970 10:29298380-29298402 CAGAGGAGGGACACTGAGGTTGG - Intronic
1065947923 10:30624287-30624309 CAGAAGAAGGACACTGAGGTTGG + Intronic
1065973639 10:30824177-30824199 TAGATCCAAGTCTCTGAGGTGGG + Intronic
1066654801 10:37687506-37687528 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067039752 10:42942976-42942998 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067051276 10:43022788-43022810 AAGAGCACAGGCCCTGAGGTGGG + Intergenic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1068959157 10:62849327-62849349 GAGTGCAAAGACCCTAAGGTGGG - Intronic
1069507552 10:69014440-69014462 TGGAGCAAAGGCTGTGAGGTTGG + Intronic
1069606986 10:69745135-69745157 CAGAGCAAAGACTCACAGCCAGG - Intergenic
1070546394 10:77456234-77456256 CAGTGCAAAGTCCCTGGGGTGGG - Intronic
1071200023 10:83211521-83211543 AAGAGAAAAGACTCAGAGGCAGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1072728830 10:97831178-97831200 CCCAGCAAAAGCTCTGAGGTTGG - Intergenic
1072740694 10:97907390-97907412 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1072787405 10:98293646-98293668 CAGAGCAATGGCACCGAGGTTGG + Intergenic
1073126148 10:101151038-101151060 CTTATCAAAGACTCTGAAGTTGG + Intergenic
1074096759 10:110320001-110320023 AAGTGGAAAGACCCTGAGGTGGG + Intergenic
1074828706 10:117233029-117233051 CTGAGCAAAGGCCCTGGGGTAGG + Intergenic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1077465049 11:2729970-2729992 CACAGCAAAGGCCCTGAAGTGGG + Intronic
1077694228 11:4379016-4379038 CATGGAAATGACTCTGAGGTGGG - Intergenic
1078761540 11:14255703-14255725 CATAGAAAGGACTCTGAGGATGG - Exonic
1079099255 11:17530750-17530772 AAGAGCATAGACTCTGAAGCAGG - Intronic
1079299370 11:19263950-19263972 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1079364072 11:19793829-19793851 CAAGGCAAAGGCCCTGAGGTGGG - Intronic
1079751633 11:24206745-24206767 TAGAGCATGAACTCTGAGGTTGG + Intergenic
1079849446 11:25512362-25512384 CAGATCAAAGACAGTCAGGTAGG - Intergenic
1080516384 11:33025196-33025218 AAGAGCAAATGCCCTGAGGTGGG - Intronic
1080684923 11:34507331-34507353 CAGAACAACCACTCTGAGATAGG + Intronic
1080851535 11:36074457-36074479 GAGTGCAAAGGCCCTGAGGTGGG + Intronic
1081406503 11:42704896-42704918 AAGAGCAAGGACTCTGTAGTAGG + Intergenic
1081686472 11:45046768-45046790 CTGACCAAAGGCTCAGAGGTGGG + Intergenic
1081750877 11:45510394-45510416 AAGAGCAAAGGCTCAGAGGGAGG + Intergenic
1082731828 11:56807379-56807401 GAGAGCAAAGATTCTGAGGAAGG - Intergenic
1083328860 11:61887631-61887653 TAGAGCAAAGGCTCAGAGGTGGG - Intronic
1084977520 11:72810755-72810777 CAGGGCAAAGCCTCCAAGGTGGG + Intergenic
1085131951 11:74047673-74047695 CATAGGAAAGACTCTGGTGTAGG + Intronic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1086079858 11:82891660-82891682 AAGTGCAAAAACCCTGAGGTAGG - Intronic
1086544685 11:87954005-87954027 ATGAGCAAAGACACAGAGGTGGG + Intergenic
1087266457 11:96066880-96066902 AAGAGCAAAGACTCTGAGATGGG + Intronic
1087342018 11:96918007-96918029 AAGTGCAAAGACCCAGAGGTGGG - Intergenic
1087705909 11:101491692-101491714 CAGTGCAAAGACTTTGTTGTTGG - Exonic
1087816754 11:102666263-102666285 GAGAGCAAAGACTCTGCGGCAGG + Intergenic
1088706525 11:112468884-112468906 ATGTGCAAAGACCCTGAGGTGGG - Intergenic
1088706528 11:112468916-112468938 AAGAGCAAAGACGCTGAGGTGGG - Intergenic
1089676329 11:120092492-120092514 CAGAGCAAAGGCTCTGAGAAGGG + Intergenic
1089773090 11:120817154-120817176 CACAGCAAAGACTGTGTGGTGGG - Intronic
1090431237 11:126648352-126648374 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1090953927 11:131497984-131498006 CAGAGGAAAGACTCAGCAGTAGG + Intronic
1091447474 12:552254-552276 AAGAGCAAAGACTTTGGGCTGGG - Intronic
1091694817 12:2621371-2621393 AAGAGCAAAGACCCCGAGGCAGG + Intronic
1091979274 12:4852651-4852673 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092033367 12:5308821-5308843 CAGAGCCAAGACTCTCAGCATGG - Intergenic
1092056991 12:5515711-5515733 CAGTGCAAAGGCACTAAGGTAGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092269641 12:7013212-7013234 GTGTGCAAAGGCTCTGAGGTAGG + Intronic
1092958392 12:13571768-13571790 CAGATCAAGGACTCTGAGCTTGG + Intronic
1093142180 12:15521739-15521761 CAGTGCAAAGACTGTCAGGGTGG - Intronic
1093234588 12:16591249-16591271 CAGTACAAAGGCCCTGAGGTGGG - Intronic
1093981616 12:25481059-25481081 AAGCCCAAAGACTCTGTGGTGGG - Intronic
1094213984 12:27921373-27921395 CAGAGCAAAGATGCTGAGGTGGG - Intergenic
1094756247 12:33472118-33472140 TTAGGCAAAGACTCTGAGGTTGG + Intergenic
1095046226 12:37510046-37510068 AAGAACAAAGACTCAGAGGCAGG - Intergenic
1095926380 12:47583718-47583740 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1096661117 12:53124608-53124630 CAGAGGCAAGACTTTGTGGTAGG + Intergenic
1096746292 12:53729522-53729544 CAAAGCAAAGATTTGGAGGTGGG + Intergenic
1097029906 12:56082671-56082693 CAGAGGAAAGAGACTGGGGTAGG + Intronic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1097790104 12:63806510-63806532 AAGAGCAAAGGCCCTGAGGCAGG + Intronic
1098358310 12:69631380-69631402 CAGAGCAGAGGCTCTGAGTCAGG - Intergenic
1098573931 12:72019404-72019426 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1099319990 12:81134168-81134190 AAGAGCAAAGAATATGAGGTCGG + Intronic
1100040729 12:90314018-90314040 CAGAGCCAACACTTTGAGGGTGG + Intergenic
1100700299 12:97140203-97140225 AGAAGCAAAGACTCAGAGGTGGG - Intergenic
1101451146 12:104780342-104780364 CTGAGCACAGATCCTGAGGTGGG - Intergenic
1101485867 12:105158996-105159018 CAGAGCAAAGCTTCTGTGCTGGG - Intronic
1101662941 12:106782677-106782699 CAGAGGGAAGACTCAGAGGTAGG - Intronic
1101680984 12:106965173-106965195 AAGAGCAAAGGCCCTGATGTGGG - Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101733200 12:107443506-107443528 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1101772660 12:107765940-107765962 AAGAGCAAAGGCCCTGAGGCAGG + Intergenic
1101788573 12:107908387-107908409 CAGAGCACAGGCTCTGGGGCAGG - Intergenic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1102400831 12:112628267-112628289 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
1102454023 12:113060513-113060535 CAGTGCAAAGGCCCTGGGGTAGG + Intronic
1102523837 12:113496788-113496810 CAGTGCAAAGGCCCAGAGGTAGG - Intergenic
1102527682 12:113523684-113523706 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
1102531510 12:113549912-113549934 AAGAGCAAAGACCTTGAGGCAGG - Intergenic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102555440 12:113723793-113723815 CAGTGCAAAGGCCCTGCGGTGGG + Intergenic
1102633798 12:114304816-114304838 AAGTGCAAAGTCCCTGAGGTGGG - Intergenic
1102807456 12:115794470-115794492 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103064227 12:117883606-117883628 GTGTGCAAAGACCCTGAGGTGGG + Intronic
1103162526 12:118741452-118741474 AAGTGCAAAGAGTCTGAGGCAGG - Intergenic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103219179 12:119229316-119229338 CAGTGCAAAAGCCCTGAGGTAGG + Intergenic
1103339099 12:120211878-120211900 CAGAACAAAGACAATTAGGTCGG + Exonic
1103662031 12:122527763-122527785 GAGTGCAAAGACTCGGAGGCTGG - Intronic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1103719847 12:122967340-122967362 AAGTTCAAAGGCTCTGAGGTGGG + Intronic
1103955731 12:124575807-124575829 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104085803 12:125473173-125473195 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1104583822 12:130031036-130031058 CAGAAAAAAGAATCTGAGGAGGG - Intergenic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1107009985 13:35660832-35660854 CGGAGCAAAGAATCTTAGCTAGG + Intronic
1107566091 13:41606146-41606168 GAGAGCAAATTCTCTGAGGGAGG - Intronic
1107618805 13:42202502-42202524 CAGAACAAAGACTTTGACCTTGG + Intronic
1108242109 13:48475526-48475548 CAGAGCAGGGACTCTGAGGGAGG + Intronic
1108974800 13:56425868-56425890 AAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1108988801 13:56629323-56629345 CAGAGCTCAGACACTGTGGTGGG - Intergenic
1109020686 13:57087997-57088019 CAGAGCACAGAGGCTGAGGTTGG + Intergenic
1109214150 13:59568575-59568597 CAGAGCAAAGAATCCAAGGAAGG - Intergenic
1110443902 13:75555138-75555160 AAGTGCAAAGACTCTGAAGCAGG - Intronic
1110709485 13:78634251-78634273 AAGAGCACAGACTCTGGGGCTGG + Intronic
1110783996 13:79501632-79501654 CAAAGCAAAAACTCTAAAGTTGG - Intronic
1114995548 14:28347262-28347284 AGGAGAAAAGACTGTGAGGTAGG + Intergenic
1115160110 14:30384267-30384289 CAGATCACAGGCTCAGAGGTTGG + Intergenic
1116455283 14:45113479-45113501 AAGAGCAGAAACTCTGAAGTAGG - Intronic
1116564235 14:46424914-46424936 AAAATCAAAAACTCTGAGGTTGG + Intergenic
1117012328 14:51483507-51483529 CAGGGCAAAGTCTCTAAGATTGG + Intergenic
1117099649 14:52333412-52333434 CAGGGCAATGACCCTGAGATGGG - Intergenic
1117292219 14:54344829-54344851 AAGTGCAAAGCCTCTGAGGAAGG - Intergenic
1117336228 14:54759364-54759386 AAGGGCAAAGGCTCTGAGGGGGG - Intronic
1117573966 14:57079007-57079029 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1117729911 14:58712075-58712097 TAAAACAAAGACTCTGATGTGGG + Intergenic
1117742228 14:58830664-58830686 AAGTGCAAATGCTCTGAGGTGGG + Intergenic
1117830051 14:59741219-59741241 CAGTGCAAAGGCCCTGAGCTGGG - Intronic
1117830868 14:59748365-59748387 TAGTGCAAAGCCGCTGAGGTAGG - Intronic
1117931198 14:60842271-60842293 CAGAGAAAAAACTCTAAAGTGGG - Intronic
1117972935 14:61270169-61270191 CTGATGAAAGACACTGAGGTTGG + Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118701459 14:68437940-68437962 TTGAACAAAGGCTCTGAGGTGGG + Intronic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119521287 14:75287755-75287777 CAGTGCAAAGTCTCTGAAGGGGG + Intergenic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119644241 14:76337053-76337075 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1119656910 14:76423805-76423827 GGGAGCAAAGACCCTGAGGTGGG + Intronic
1119672206 14:76528304-76528326 CTGAGCTAAGATTCTGATGTCGG - Intergenic
1119897245 14:78230654-78230676 AATTGCAAAGACTCTGAGGTTGG + Intergenic
1119935112 14:78585268-78585290 CAGTGCAAAGGACCTGAGGTGGG + Intronic
1120383357 14:83811258-83811280 CACAGCAAAGACCTTGAGATGGG + Intergenic
1121008775 14:90507666-90507688 CTGAGCAGAGGCACTGAGGTGGG - Intergenic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121307886 14:92918203-92918225 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1121502921 14:94452728-94452750 CAGAGCAAAGGCACTGAGCAGGG + Exonic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1121851920 14:97229102-97229124 CAGAACAAAGTCTCTGAGTTAGG + Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122353332 14:101109984-101110006 TTGAGCAAAGACTTGGAGGTGGG + Intergenic
1122482154 14:102054300-102054322 CAGAGGGAAGACTCGGGGGTGGG - Intergenic
1122886854 14:104714037-104714059 CAGACCAAGGACGCTGAGGCCGG + Intronic
1124221233 15:27851435-27851457 CTGAGCCACGACCCTGAGGTTGG - Exonic
1124720089 15:32104275-32104297 CAGTGCAAAGGCCCTGAGGGGGG - Intronic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1125790225 15:42359887-42359909 CAGAGCAAGGCCACTGAGGCTGG + Exonic
1126288884 15:47048496-47048518 AAGAACAAAGACTCAGAGGCAGG + Intergenic
1126534579 15:49747521-49747543 CAGTACAAAGGCTCTGAGGCAGG + Intergenic
1126731347 15:51686359-51686381 CAGAGCAAAGACTCTTCAGTGGG + Intronic
1126745923 15:51826583-51826605 CAGCATAAAGACTCTGAGATGGG + Intergenic
1127146290 15:56027504-56027526 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1127292080 15:57579953-57579975 TGGAACACAGACTCTGAGGTGGG - Intergenic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1127961731 15:63895334-63895356 TTGAGCAAAGACACAGAGGTAGG - Intergenic
1128317574 15:66670952-66670974 AAGGGCAAAGGCCCTGAGGTGGG + Intronic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1128705185 15:69832932-69832954 CAGTGCAAAGGCCCTGAGCTGGG - Intergenic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129064022 15:72885953-72885975 CAGAGCAACGGTTCAGAGGTTGG + Intergenic
1129543054 15:76366930-76366952 CAGCCCTGAGACTCTGAGGTGGG + Intronic
1129756052 15:78099829-78099851 CAGTGCAGAGGCCCTGAGGTGGG - Intronic
1130042094 15:80413651-80413673 AAAAGGAAAGACTCTGAGGTAGG + Intronic
1130905150 15:88234929-88234951 CAGTGCAACGCCTCTCAGGTTGG - Intronic
1131078334 15:89513280-89513302 CAGAGCAAAGGCCCTGAGAGGGG + Intergenic
1131246213 15:90795976-90795998 TAGAGCAAAGGCCCTAAGGTGGG + Intronic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131380697 15:91961599-91961621 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1132077501 15:98834611-98834633 CAAAGCAGTGACTGTGAGGTGGG + Intronic
1132268884 15:100505170-100505192 CATAGCAATGACACTGAGTTAGG + Intronic
1133467928 16:6045897-6045919 CAGGGCAAAGGCCCTGAAGTAGG + Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1133906957 16:10031261-10031283 AATGGCAAAGACCCTGAGGTGGG - Intronic
1134030885 16:10991455-10991477 CAGTGCAAAGGCCCTGCGGTGGG + Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134071041 16:11259965-11259987 CAGTGCAAAGGCCCTGTGGTGGG + Intronic
1134739364 16:16529122-16529144 CAGTGCAAAGGTCCTGAGGTGGG + Intergenic
1134928136 16:18183029-18183051 CAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1135052701 16:19205322-19205344 TAGTGCAAAGGCCCTGAGGTAGG - Intronic
1135123321 16:19785343-19785365 CTTAGCAAAGGCCCTGAGGTGGG + Intronic
1135159241 16:20078864-20078886 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1135180468 16:20269343-20269365 AAGAGCAAAGGCCCTGAGATGGG + Intergenic
1135967191 16:27045894-27045916 AGGAGGAATGACTCTGAGGTGGG + Intergenic
1136015738 16:27399633-27399655 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1136036100 16:27541754-27541776 CAGAGTGAAGAAACTGAGGTCGG + Intronic
1136378057 16:29877005-29877027 CAGAGCAAAGCCTCCGAGGCTGG - Intronic
1137789206 16:51160598-51160620 AAGTGCAAAGATCCTGAGGTGGG + Intergenic
1137919715 16:52474957-52474979 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138335347 16:56248723-56248745 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1138536390 16:57662616-57662638 AAGAACAAAGATCCTGAGGTTGG + Intronic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1140128132 16:72134682-72134704 AAGTGCAAAGGCACTGAGGTGGG - Intronic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140342160 16:74174988-74175010 CTGTGCAAAAACCCTGAGGTGGG + Intergenic
1140395144 16:74620033-74620055 CAGAACAAAGAAACTGAGGCAGG + Intergenic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141115864 16:81308837-81308859 CAGTGCAAAAGCCCTGAGGTGGG + Intergenic
1141157226 16:81605650-81605672 CAGTGCAAAGGCTCAGAGGTGGG - Intronic
1141171381 16:81693831-81693853 CAGAGCAAGGAATCTGAGCTGGG + Intronic
1141344137 16:83229859-83229881 CAGACCAAACACTCTGAAGCTGG + Intronic
1141481033 16:84307065-84307087 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1141926082 16:87170528-87170550 CAGTGCAAAGGCCCTGGGGTAGG - Intronic
1142308152 16:89297081-89297103 CAAGGCAGAGACCCTGAGGTTGG + Intronic
1142642181 17:1290651-1290673 CAGAGCACAGACCATGATGTGGG - Intronic
1143137433 17:4719733-4719755 GAAAACAAAGACTCAGAGGTGGG + Intronic
1143327161 17:6106887-6106909 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1143458498 17:7083686-7083708 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1144590211 17:16517330-16517352 CAGATCAGAAACTCTGGGGTGGG + Intergenic
1144762008 17:17712375-17712397 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1144961120 17:19044749-19044771 CAGTGCCAAGGCTCTGAGGTGGG + Intronic
1144974041 17:19129775-19129797 CAGTGCCAAGGCTCTGAGGTGGG - Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145230720 17:21171534-21171556 CAGAGCAGACACTCAGAGGACGG - Intronic
1145240283 17:21236944-21236966 GAGGGCATAGCCTCTGAGGTGGG + Intergenic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1145253161 17:21307485-21307507 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1145323410 17:21780433-21780455 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1146442338 17:32908018-32908040 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
1146548131 17:33756653-33756675 GCCAGCAGAGACTCTGAGGTAGG + Intronic
1146733847 17:35219977-35219999 AAGAGCATAGTCTCTGGGGTTGG - Intergenic
1146842550 17:36166038-36166060 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146854862 17:36253997-36254019 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146865758 17:36334379-36334401 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1146870762 17:36377889-36377911 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146878120 17:36428970-36428992 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146882061 17:36450074-36450096 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1147034117 17:37667342-37667364 CAGAGCAAAGTCTGTGGGGAAGG + Intergenic
1147068628 17:37934991-37935013 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1147073645 17:37978513-37978535 CAGAGGCAAGGCCCTGAGGTGGG + Intronic
1147080150 17:38014528-38014550 CAGAGGCAAGGCCCTGAGGTGGG - Intronic
1147085167 17:38058051-38058073 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1147096099 17:38138488-38138510 CAGAGGCAAGGCCCTGAGGTGGG - Intergenic
1147101113 17:38182017-38182039 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1147218930 17:38916945-38916967 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
1147997359 17:44367931-44367953 CAGTGAAAAGGCCCTGAGGTAGG - Intergenic
1148488808 17:48009898-48009920 ATGAGCAAAGACTATGAGGATGG - Intergenic
1148752295 17:49952190-49952212 CTGAGCAAAGAGTCTGTGGATGG - Intergenic
1148972104 17:51492569-51492591 CAGTGCAAAGGCCCTTAGGTGGG + Intergenic
1149455612 17:56785776-56785798 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1149756519 17:59190961-59190983 CAGAGCAGAGCTTCTGAAGTGGG - Intronic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150588660 17:66541311-66541333 CAGAGGCAAGAGTTTGAGGTGGG - Intronic
1150634853 17:66905706-66905728 CATGGGAAAGGCTCTGAGGTGGG + Intergenic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1152887108 17:82859005-82859027 CCGAGCAAAGACAATGAGGGTGG - Intronic
1153147989 18:2055593-2055615 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG + Intergenic
1155994061 18:32311665-32311687 CTGCCCAAAGACTCTCAGGTGGG + Intronic
1156218889 18:35030899-35030921 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1156516208 18:37682823-37682845 CAGAACAAAGGCCCTAAGGTAGG + Intergenic
1156569832 18:38240808-38240830 AAGTGCAAAGGCTCTGGGGTGGG + Intergenic
1157042871 18:44060979-44061001 CAGAGAGGAGACTCTGTGGTGGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1158925459 18:62253217-62253239 AAGAACAAAGGCCCTGAGGTGGG + Intronic
1159244254 18:65784376-65784398 AAGAGCACAGACTCTGAAGCAGG + Intronic
1160688169 19:446952-446974 CATGGCAAAGCCTATGAGGTGGG - Intronic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161302111 19:3547784-3547806 CAGAGCAAAGGCCCTGTGGGTGG + Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161635306 19:5384966-5384988 CAGAGCAAAGGCCCTGCGGCAGG - Intergenic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161734098 19:5979746-5979768 AAGTGCAAAGACCCTTAGGTTGG - Intergenic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162189140 19:8931060-8931082 AGGTGCAAAGACTCTGAGGGTGG + Intronic
1162194580 19:8974561-8974583 GAAACCAAAGACTCTGAAGTGGG + Exonic
1162295542 19:9811010-9811032 CAGCTCAAGGACTCTGAGCTTGG + Exonic
1162418154 19:10550639-10550661 AAGCGCAAAGGCCCTGAGGTGGG - Intronic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162554782 19:11380048-11380070 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163157453 19:15447255-15447277 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
1163183183 19:15618302-15618324 GAGAGAAAAGACACTGAGGTTGG - Intronic
1163223132 19:15935735-15935757 CAGATGAAAGATTCTGAGGAGGG + Intergenic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163468553 19:17483813-17483835 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1164700117 19:30279042-30279064 AAGTGCAAAGGCCCTGAGGTTGG - Intronic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165463920 19:35960786-35960808 CAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1165619175 19:37230120-37230142 CAGAGCAACATCACTGAGGTGGG + Intronic
1165700445 19:37933235-37933257 CAGGGCAAAGTCTCCGAGGGAGG - Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1165853879 19:38868758-38868780 CAGTGCAAAGGCCCAGAGGTAGG - Intronic
1165866596 19:38943098-38943120 CCGCGCAAAGGCCCTGAGGTGGG + Intronic
1165950587 19:39472222-39472244 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1166007338 19:39916544-39916566 CAATGCAAAGGCCCTGAGGTGGG - Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166500390 19:43336708-43336730 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1166509788 19:43397303-43397325 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1166929187 19:46291098-46291120 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167347790 19:48957098-48957120 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1167485183 19:49758604-49758626 CAGGGCAAAGAGTCTGGGCTGGG - Intronic
1167552493 19:50170528-50170550 TAGAGCACAGGCTCTGAGGCCGG - Intergenic
1167555547 19:50192989-50193011 CCGTGCAAAGGCCCTGAGGTGGG + Intronic
1167569484 19:50277997-50278019 CAGTGCAAAGGCCCTGAGATGGG + Intronic
1167587265 19:50382267-50382289 CTGAGGAAAGACTCTGCGGAGGG - Intronic
1167637498 19:50663381-50663403 CAGTTCAAAGGCCCTGAGGTGGG - Intronic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
1168008403 19:53509670-53509692 CACAGCTAAGCCTCTGTGGTAGG + Intergenic
1168349287 19:55666911-55666933 CAGAGCAAAGACACACAGGCAGG - Intronic
925280915 2:2683752-2683774 CAAAGCCACGACTCTGTGGTCGG - Intergenic
925454794 2:4007016-4007038 CAGAGCTTAGACTCTGCAGTGGG - Intergenic
926429576 2:12772356-12772378 AGGAGCCAAGGCTCTGAGGTGGG + Intergenic
926764619 2:16313416-16313438 CATTGCAAAGTCTCGGAGGTGGG + Intergenic
926812977 2:16772829-16772851 CAGCGCAAAGGCTCTGAGCAGGG - Intergenic
927627844 2:24742286-24742308 AAGAGGAAAGACACTGACGTGGG + Intronic
928256018 2:29723259-29723281 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
928537935 2:32258174-32258196 CAGAGGAACGACTCGGAGTTTGG - Intronic
928666240 2:33553182-33553204 GTGAGCAAAGGCACTGAGGTGGG - Intronic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
929852442 2:45604604-45604626 AAGTGCAAAGACCCTGAGGCAGG - Intronic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
930036083 2:47086056-47086078 CAGAGGAAAGAGTCAGGGGTGGG - Intronic
930122622 2:47772227-47772249 CAGTGCAGAGGCTCTGAGATGGG + Intronic
931183987 2:59931799-59931821 ACGTGCAAAGACCCTGAGGTAGG + Intergenic
931190138 2:59992374-59992396 TAGAGCATAGCCTCTGAGGCAGG + Intergenic
931583179 2:63799532-63799554 TTGAGAAAAGACTCTGATGTTGG - Intronic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
932598761 2:73110426-73110448 CAGAGGAAAGTCTGTGAAGTTGG - Intronic
932817804 2:74875623-74875645 CAAAGCAAGGACTCTCAGGCCGG - Intronic
933771588 2:85748083-85748105 CAATGCAAAGGCCCTGAGGTGGG + Intergenic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
934689260 2:96345714-96345736 CTGACAAAAGACTCTGGGGTGGG + Intronic
934947654 2:98553684-98553706 CACAGCATAGAGTGTGAGGTGGG + Intronic
935316344 2:101838215-101838237 CAGACCAGAAACTTTGAGGTTGG - Intronic
936904496 2:117521473-117521495 AAGTGGAAAGACACTGAGGTAGG - Intergenic
936951880 2:117985825-117985847 CAGAGAAAAGTCCCTGATGTTGG + Intronic
937164001 2:119795076-119795098 CAGAGAGGAGACCCTGAGGTGGG + Intronic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937478152 2:122233518-122233540 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
937705042 2:124910920-124910942 CAGAGCAAAGACTCAGATTAAGG + Intronic
938774015 2:134525277-134525299 CTGATCAGAGACTCTGGGGTGGG + Intronic
939413872 2:141866935-141866957 CATGGCAAAAACTCTGAGTTTGG - Intronic
939892886 2:147758179-147758201 CAGTGCAAAGGCCTTGAGGTGGG - Intergenic
940748293 2:157595787-157595809 AAGAGCAAAGGCCATGAGGTGGG - Intronic
941005765 2:160245356-160245378 CAGTGCAAAGGCCCTGAGATGGG - Intronic
941162983 2:162055978-162056000 AAGTGCAAAGTCTCTGAGGCAGG - Intronic
941619558 2:167761033-167761055 CTGAGAAAAGACTCTATGGTGGG + Intergenic
941702803 2:168622659-168622681 CAATGCAAAGTCTTTGAGGTTGG - Intronic
942525976 2:176853433-176853455 CAGAGCAAAGCCTATTGGGTAGG + Intergenic
942619093 2:177828671-177828693 CAGTGCAAAGCCCCTGAGGTGGG + Intronic
942665330 2:178311221-178311243 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
942752080 2:179299604-179299626 AAGAACAAAGGCTCTGAGGTGGG - Intergenic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
944028549 2:195202758-195202780 CAGAGAAAAGATTATCAGGTGGG - Intergenic
944511277 2:200468601-200468623 CAGAGCAGAGAAGCTGAGGAGGG - Intronic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
944822593 2:203445652-203445674 CTGAGCAAGGAGGCTGAGGTGGG + Exonic
944968240 2:204960993-204961015 AAGTGCAAAGACCCTGAGGCAGG + Intronic
946106689 2:217376565-217376587 CAGAGCAAAGGCCCTGAGACGGG + Intronic
946146583 2:217735581-217735603 AGGAGCAAAGGCCCTGAGGTGGG - Intronic
946149492 2:217754621-217754643 CAGAGCAATGTGTCTGAGGCTGG + Intronic
946590147 2:221237434-221237456 AAAAGCAAAGACTCTGGGGCAGG + Intergenic
946872895 2:224100844-224100866 ATGTGCAAAGACTCTGAGGTGGG - Intergenic
947288292 2:228542895-228542917 GAGTGCAAAGACTCTGAGCTGGG - Intergenic
947330791 2:229027417-229027439 CAGAGCACAGTCTTTGAGGCAGG + Intronic
947541022 2:230978288-230978310 CAGAGCAAACACTCTGATTGTGG + Intergenic
947549052 2:231033470-231033492 CGGAGGAAAGAGGCTGAGGTGGG - Intergenic
948121068 2:235530860-235530882 CAGAGGAAGGACACTGAGGTGGG - Intronic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
948456097 2:238105295-238105317 CAGAGCAGAGTGGCTGAGGTTGG + Intronic
1168742294 20:202078-202100 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1168832405 20:853791-853813 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168952771 20:1813849-1813871 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
1168957491 20:1844613-1844635 AAGTGCAAAGTCCCTGAGGTGGG + Intergenic
1168964000 20:1887940-1887962 CCGTGCAAAGGCCCTGAGGTAGG + Intergenic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1168978289 20:1984198-1984220 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1168981171 20:2005052-2005074 AAGAGCAAACACCCTGAGGTGGG - Intergenic
1169006541 20:2212099-2212121 CTGTGCAGAGTCTCTGAGGTAGG + Intergenic
1169394698 20:5219200-5219222 GAATGCAAAGACTCCGAGGTGGG - Intergenic
1169539326 20:6582104-6582126 CAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170048312 20:12111548-12111570 GAGTGCAAAGACTATGAGGCAGG + Intergenic
1170412953 20:16110050-16110072 AAGAGAAAACACACTGAGGTGGG + Intergenic
1170911454 20:20574297-20574319 TAGAGCAAAGGCTGTGAGATAGG + Intronic
1171036260 20:21714813-21714835 CAGAGCAAGGATTGTGAGGAGGG - Exonic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1171540789 20:25953647-25953669 AAGAACAAAGACTCAGAGGCAGG - Intergenic
1171800282 20:29606670-29606692 AAGAACAAAGACTCAGAGGCAGG + Intergenic
1171843818 20:30250033-30250055 AAGAACAAAGACTCAGAGGCAGG - Intergenic
1171987764 20:31672500-31672522 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172039098 20:32031347-32031369 CAAAGCTGAGACTCAGAGGTGGG - Exonic
1172065789 20:32219355-32219377 AGGAGCAAAGACCCTGAGGCAGG + Intronic
1172107509 20:32525394-32525416 CAGGGCACAGGCTCTGGGGTGGG + Intronic
1172281838 20:33713290-33713312 CAGTGCAAAGACCTTGAGATAGG - Intronic
1172291473 20:33780206-33780228 CAGTGCCAAGGCCCTGAGGTGGG + Intronic
1172563250 20:35907633-35907655 CAGAACAAACCCTCTGAGGTGGG + Intronic
1172784172 20:37455453-37455475 AAGTGCAAAGGCTCTAAGGTGGG - Intergenic
1172818624 20:37711791-37711813 CAAAACAAAAACTCTGAGGTGGG + Intronic
1172867650 20:38112500-38112522 CAGAGCCCAGACTTTCAGGTGGG + Intronic
1173041173 20:39464372-39464394 AAGAGCAAAGACCTTGAGGCAGG + Intergenic
1173081457 20:39872053-39872075 AAGAGCACAGGCTCTGGGGTAGG + Intergenic
1173146286 20:40527386-40527408 CAGAGAAGAGAAGCTGAGGTGGG - Intergenic
1173450293 20:43157786-43157808 TAGAGCAAAGACTCCAAGGTGGG + Intronic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1173802907 20:45905983-45906005 ATGAGCAAAGGCCCTGAGGTGGG + Intronic
1173919084 20:46730561-46730583 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1173990899 20:47302661-47302683 CAGAGCAAAGACTCAAACCTGGG + Intronic
1174117614 20:48237992-48238014 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174170652 20:48616220-48616242 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1174264966 20:49324712-49324734 CAGTGCAAAGTCGCTGAGGCAGG - Intergenic
1174268303 20:49347933-49347955 CAGAGCACAGCGTCTGAGGGTGG + Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174385370 20:50185653-50185675 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1174390113 20:50213810-50213832 AAGTGCAAAGGCTCTGAGATGGG + Intergenic
1174394693 20:50239723-50239745 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174428284 20:50448844-50448866 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1174887186 20:54348785-54348807 AAGGTCAAAGACCCTGAGGTAGG + Intergenic
1175004429 20:55667136-55667158 AAGAGCAAAGACCCAGAGGTGGG + Intergenic
1175040040 20:56040349-56040371 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1175327101 20:58137502-58137524 AAGTGCAAAGGCGCTGAGGTGGG + Intergenic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1175520576 20:59600109-59600131 CTGAGCGAAGACCATGAGGTGGG - Intronic
1176093902 20:63330870-63330892 CAGAGCCAAGAGTATGGGGTGGG - Exonic
1176449425 21:6849998-6850020 TAGACCAAGGACTCTGTGGTGGG + Intergenic
1176827595 21:13715022-13715044 TAGACCAAGGACTCTGTGGTGGG + Intergenic
1177381249 21:20347247-20347269 CAGAGCAAAGACACTGACTTTGG - Intergenic
1177832038 21:26149911-26149933 CAGTGTAAAGGCTGTGAGGTGGG - Intronic
1177904399 21:26958169-26958191 CAGTGCAAATACGCTGAGGGAGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1178818652 21:35954924-35954946 CAATGCAAAGATTCTGTGGTGGG - Intronic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181409852 22:22711214-22711236 CAGAGCAAAGGCAGGGAGGTGGG - Intergenic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181785357 22:25222633-25222655 AGGCGCAAAGACTCCGAGGTGGG + Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1181888498 22:26040720-26040742 CAATGCAAAGGCCCTGAGGTAGG + Intergenic
1181971724 22:26695670-26695692 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
1182071407 22:27466340-27466362 CAGATCAAAGATTCAGAGCTGGG - Intergenic
1182404894 22:30118298-30118320 CAATGCAAAGGCTCTGAAGTGGG - Intronic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1183090365 22:35518257-35518279 CTGAGCAAAGGCTGGGAGGTAGG + Intergenic
1183154405 22:36063959-36063981 CAGTGCAATGGCCCTGAGGTAGG - Intergenic
1183253082 22:36744032-36744054 CAGGCCAGAGACCCTGAGGTGGG - Intergenic
1183310852 22:37108803-37108825 CAGAGCAGGGACTCTGGGCTAGG + Intronic
1183340063 22:37275089-37275111 CTGAGCACAGACTCTGAGCCAGG - Intergenic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
1184099085 22:42332277-42332299 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1185233231 22:49695077-49695099 AGCAGCAAAGACTCTGATGTGGG + Intergenic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
949430827 3:3973673-3973695 AAGAGCAAAGACTGAGAGGAAGG + Intronic
949478749 3:4473127-4473149 AAGTACAAAGACCCTGAGGTAGG - Intergenic
949841862 3:8328592-8328614 CAGACCTAGGACCCTGAGGTCGG - Intergenic
949879467 3:8650031-8650053 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950456988 3:13098622-13098644 CAGTGGAAAGGCTCTGAGCTAGG + Intergenic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
951343375 3:21516161-21516183 CTCTCCAAAGACTCTGAGGTTGG - Intronic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
952038579 3:29234197-29234219 CCATGCAAAGGCTCTGAGGTAGG + Intergenic
953718435 3:45335340-45335362 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
954576504 3:51679227-51679249 CAAAACAAAAACCCTGAGGTAGG - Intronic
954588028 3:51753808-51753830 CAGAGGTCAGACACTGAGGTGGG - Intergenic
954772416 3:52983694-52983716 AAGAGCAAAGTCTCTGAAGTGGG + Intronic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
955093326 3:55773251-55773273 CAGTGCAAAGGCCCTAAGGTGGG - Intronic
955097326 3:55812340-55812362 AAGAGCAAGTATTCTGAGGTTGG + Intronic
955454917 3:59109616-59109638 AAGTGCAAAGATTCTGTGGTGGG + Intergenic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
956897979 3:73683319-73683341 AAGTGCAAAGTCTCTGAGGCAGG + Intergenic
957238707 3:77629104-77629126 CAGAGCAAAGACACAAAGGCTGG + Intronic
958177941 3:90020907-90020929 CATAGCAAAGTATCTGTGGTGGG + Intergenic
958715832 3:97779250-97779272 CAGTGCAATGATTCTGAGGAAGG - Intronic
959000334 3:100956848-100956870 CAGTGCAAAGACTCAGAGAAAGG + Intronic
959423422 3:106155718-106155740 CATAAGAAAGACCCTGAGGTGGG + Intergenic
960117021 3:113905409-113905431 CAGAACAAAGGCTCTGCAGTAGG - Intronic
960300497 3:115997604-115997626 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
961002290 3:123382105-123382127 CAGATCAAAGGCCCTGGGGTGGG - Intronic
961175609 3:124832612-124832634 CAGAGAACAGACTCTGTGGAAGG - Intronic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
961901643 3:130218724-130218746 ATGAGCAAAGACACAGAGGTGGG - Intergenic
961983955 3:131112759-131112781 CAGAGCACAGCCACAGAGGTGGG + Intronic
962120423 3:132555011-132555033 AAGTGCAAAGACCCTGAAGTAGG + Intergenic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
962396020 3:135015897-135015919 CAGGACAAAGGCCCTGAGGTGGG + Intronic
962445540 3:135460406-135460428 CAGAGCATGTACTCTGAGTTAGG + Intergenic
963043200 3:141083933-141083955 GAGGGGAAAGACTCTGAAGTTGG + Intronic
963846982 3:150169288-150169310 CAAAGCTCAGACTCTGAAGTTGG - Intergenic
964304520 3:155326176-155326198 CAGAGAAAAGATTTTGAGCTGGG - Intergenic
964419688 3:156488453-156488475 CAGTGCAAAGGCCCTGAGATGGG + Intronic
964523775 3:157595312-157595334 CAGAACAAAGACTGAGAAGTGGG + Intronic
964841157 3:160994948-160994970 CAATGCAAGGACCCTGAGGTGGG + Intronic
965412284 3:168347012-168347034 GTGTGCAAAGACACTGAGGTAGG + Intergenic
965696452 3:171413471-171413493 CAGTGCAAAGATGCAGAGGTGGG - Intronic
965859123 3:173125559-173125581 CAGTGCAAAGGTTCTGAGTTGGG - Intronic
966599792 3:181763777-181763799 AAGTGCAAAGGCTCTGTGGTAGG + Intergenic
967048370 3:185758466-185758488 CAAAGCAAACCCTGTGAGGTAGG - Intronic
967300177 3:188004865-188004887 CAGGGCAATGTCTCTGATGTTGG + Intergenic
967338570 3:188371591-188371613 CAGAGGAAAGACTGAGTGGTGGG + Intronic
967741570 3:193008850-193008872 AAGTGCAAAGACCCTGAGGCTGG - Intergenic
967896383 3:194399372-194399394 CAGAACAAGGGCTCTGAGATAGG - Intergenic
967907033 3:194509963-194509985 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
968016385 3:195337974-195337996 CAGTGCAAAGGCATTGAGGTGGG - Intronic
968808469 4:2789530-2789552 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
968821976 4:2861124-2861146 AAGTACAAAGACTCTGAGGCAGG + Intronic
969083260 4:4636582-4636604 AAGTGCGAAGACCCTGAGGTGGG + Intergenic
969317795 4:6392558-6392580 ACGAGCAAAGGCCCTGAGGTAGG + Intronic
969435687 4:7188034-7188056 CAGACCAGAAACTCTGGGGTAGG - Intergenic
969503854 4:7571361-7571383 AAGGGCAAAGACTCAGAGGTGGG + Intronic
970060701 4:12030200-12030222 CAGAACAAAGACTTTGAGGCAGG - Intergenic
970140561 4:12977500-12977522 CAGAGGAAAGACCATGTGGTTGG - Intergenic
970406883 4:15772599-15772621 CAGACCAGAGCCTCTGAGATGGG + Intergenic
971043702 4:22781988-22782010 CAGAAGAAAGTCTCTGAGTTGGG + Intergenic
971271141 4:25147093-25147115 AACAGCCAAGACTCTGAGGCAGG - Intronic
971423094 4:26491638-26491660 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
971437941 4:26647734-26647756 AAGAGCAAAGACACTCAGCTGGG - Intronic
971552122 4:27970531-27970553 CAGAGCAAAGATTCTGAAGCAGG - Intergenic
971724430 4:30291491-30291513 TAGAGCAAAGATTCTGAAGCAGG - Intergenic
971861447 4:32110954-32110976 AAGAGCAAAGACCCTGAGAAAGG + Intergenic
972205420 4:36766169-36766191 CAGAGAGAAGGCTCTGAGATGGG + Intergenic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973333164 4:48930521-48930543 AAGTGCAAAGACCCTGAGGTTGG + Intergenic
973644572 4:52937204-52937226 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
973794049 4:54405875-54405897 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
973855399 4:55006071-55006093 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
973925303 4:55730888-55730910 CAGAGCCAGGACTCTGACCTAGG + Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
975855982 4:78624842-78624864 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976592585 4:86863708-86863730 AAGAGCAAAGGCTCTAAGGTGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976913505 4:90339594-90339616 AAGTGCAAAGACACTGGGGTGGG - Intronic
977312005 4:95399615-95399637 AAGAGCAAAGGCCCTGAGGCAGG - Intronic
977843993 4:101745001-101745023 CAGAACAAAGACACTGAGTCCGG - Intronic
978219701 4:106256002-106256024 CAGAGAGAAGACCCTGGGGTGGG + Intronic
979295136 4:119023439-119023461 CAGAGCAAAGCCTCTGGGTCTGG + Exonic
980501833 4:133666060-133666082 CAGTGGAAAGGCCCTGAGGTAGG - Intergenic
980671171 4:136008838-136008860 CAGAGACAAGACCCTGGGGTGGG - Intergenic
981145905 4:141323820-141323842 CAGAGCAAAGGCTATGACTTGGG + Intergenic
981423137 4:144574226-144574248 CAGAGCAGGGACTCCAAGGTAGG + Intergenic
981562159 4:146059687-146059709 CAGTGCAAAGAGCCTGGGGTGGG - Intergenic
982090346 4:151875106-151875128 CAGGGCAAAGGCTCAAAGGTGGG + Intergenic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
982445786 4:155489405-155489427 CAGTGCAAAGGCCCTGAAGTGGG + Intergenic
982705466 4:158704432-158704454 GTGAGCAAAGACCATGAGGTGGG - Intronic
982761412 4:159288822-159288844 CAGAGTAAAGACCTTCAGGTGGG - Intronic
983653979 4:170062457-170062479 CAGAGTAAAGGCCCTGAGATGGG + Intronic
984673879 4:182524700-182524722 AAAAGCAATGACTCTGAGTTTGG - Intronic
984731374 4:183070880-183070902 CACAGCAAGGACTCTGAGGAAGG - Intergenic
985723103 5:1501042-1501064 CAGAGCTGAGGGTCTGAGGTGGG + Intronic
987492957 5:18604349-18604371 CAGAGCAAAATCCCTGAGGTGGG + Intergenic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
988586013 5:32508162-32508184 CACAACAAAGAGTCGGAGGTGGG - Intergenic
988864831 5:35323882-35323904 CAGAGGGAAGACACTGAAGTGGG + Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
988952193 5:36274493-36274515 AAGAGGAAAGTCTCTGAGGAAGG + Intronic
989110610 5:37903533-37903555 CAGTGGAAAGGCCCTGAGGTGGG + Intergenic
989210687 5:38856020-38856042 CTCTGCAAAGACCCTGAGGTTGG - Intronic
990025317 5:51180572-51180594 CAGAACTAAGACTCTAAGATGGG - Intergenic
990487546 5:56274150-56274172 CAGAGCAAAGGCACCCAGGTGGG - Intergenic
990871806 5:60440088-60440110 CCTCGCAAAGACTCTGAAGTAGG - Intronic
991359253 5:65802850-65802872 CAGAGAAGAGACCCTGGGGTGGG + Intronic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
991960358 5:72038159-72038181 ATGGGCAGAGACTCTGAGGTTGG - Intergenic
992505248 5:77380967-77380989 AAGTACAAAGACTCGGAGGTGGG + Intronic
992679612 5:79141009-79141031 CAGTGCCAAGGCTCTGAGGTAGG - Intronic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
995542402 5:113197833-113197855 CAGAGCACAGGCTCTGGAGTTGG - Intronic
995589163 5:113680688-113680710 GAGAGCCAAGTCTCTGAGGCAGG - Intergenic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997362900 5:133306372-133306394 CAGAGCACTTACTCTGAGGAGGG + Intronic
997660098 5:135582745-135582767 GAGCACAAAGACCCTGAGGTGGG - Intergenic
997668359 5:135650189-135650211 CTCAGCAAGGACTATGAGGTTGG - Intergenic
998155533 5:139784682-139784704 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
998368841 5:141648440-141648462 GAGTGCAAAGGGTCTGAGGTGGG - Intronic
998375315 5:141686833-141686855 GAGTGCAAAGGCCCTGAGGTAGG + Intergenic
998389017 5:141774957-141774979 AAGTGCAAAGGTTCTGAGGTGGG - Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998547289 5:143040753-143040775 TGGAGCAAAGGCTATGAGGTGGG + Intronic
998601416 5:143589105-143589127 CAGAGCAAAGAAGCTCAGCTTGG - Intergenic
998778978 5:145634999-145635021 GTGAACAAAGACTCAGAGGTAGG - Intronic
998835236 5:146196857-146196879 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999307021 5:150526082-150526104 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
999636805 5:153631570-153631592 CAGAGAGACGACTCTAAGGTTGG + Intronic
999652598 5:153782296-153782318 AAGAGCATAGACTCTGAACTTGG - Intronic
999663332 5:153888409-153888431 AAGAGCAAAGCCTCTGCAGTGGG + Intergenic
999816922 5:155186391-155186413 TAATGCAAAGGCTCTGAGGTGGG + Intergenic
999988948 5:157031963-157031985 GAGTGCAAAGGCACTGAGGTAGG - Intronic
1000098786 5:157994650-157994672 AAGTGCAAAGGCTCCGAGGTGGG + Intergenic
1000244945 5:159441608-159441630 CAGAGCTGTGGCTCTGAGGTCGG + Intergenic
1000286784 5:159833709-159833731 AAGAGCAAAGGCACTGAGGAAGG + Intergenic
1000827066 5:166058335-166058357 GAGAGCAAATACTATGAGGGAGG + Intergenic
1001134645 5:169092223-169092245 CAAAAAAAAGACTCAGAGGTAGG + Intronic
1001279909 5:170379219-170379241 CAGAGCCAGGACTCCAAGGTAGG - Intronic
1001590484 5:172861188-172861210 CTTGGCCAAGACTCTGAGGTGGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001776704 5:174334284-174334306 CAGAGCACAGAGGCTGAGGCTGG + Intergenic
1002068714 5:176665696-176665718 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1002691657 5:181054185-181054207 AAGGGGAAAGACTCTCAGGTTGG - Intronic
1003238059 6:4316398-4316420 CAAATCAAAGTCTCTGAGGTGGG + Intergenic
1003268628 6:4588480-4588502 CTGAGCAAATGCTCTGAGGATGG - Intergenic
1003455527 6:6278433-6278455 CAGTGCAAAGACCCTGTGGGAGG + Intronic
1003882886 6:10494347-10494369 GAGAGCCAAGATTCTGGGGTAGG - Intronic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1005108446 6:22251188-22251210 CAATCCAAAAACTCTGAGGTTGG + Intergenic
1005715126 6:28539879-28539901 CAGAGCAGGAACTCTGAGCTTGG - Intergenic
1005726287 6:28651969-28651991 AAAAGCAAAGACTGTGAGCTAGG + Intergenic
1006430847 6:33994870-33994892 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1006457479 6:34140234-34140256 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1006511515 6:34524041-34524063 CAGAGCAGGGACCCTGAGGTTGG + Intronic
1006809974 6:36813727-36813749 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006835521 6:36996734-36996756 AAGAGCAAAGGCCCTGAGGTGGG + Intergenic
1006913305 6:37578308-37578330 CGGAGCAAAGGCCCTGGGGTAGG + Intergenic
1006929405 6:37678651-37678673 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007116111 6:39344529-39344551 CAGAGCAAAGGCCCTGAGGCTGG - Intronic
1007250401 6:40491235-40491257 AAGAGGAAAGACATTGAGGTGGG - Intronic
1007491580 6:42227104-42227126 CAGAGCAAAGTCATGGAGGTTGG + Exonic
1007630233 6:43269455-43269477 CAGAGCCTAGATTCTGAGGCAGG + Intronic
1007718873 6:43873579-43873601 AAGCGCAAAGGCTCTGAGGCAGG + Intergenic
1009423226 6:63486540-63486562 CAGGGCAAAGATGCAGAGGTAGG + Intergenic
1010534833 6:77013669-77013691 CTGAGCATACACTCTGAGGCTGG - Intergenic
1010700942 6:79046195-79046217 CAGTGCAAAGACCCTAAGTTTGG - Intronic
1010881978 6:81187667-81187689 AAAAGCAGAGTCTCTGAGGTTGG - Intergenic
1010999392 6:82570764-82570786 AAGTGCAAAGGCTGTGAGGTAGG + Intergenic
1011062394 6:83285679-83285701 AAAAGCAAAGACCCTGAGGTGGG + Intronic
1011554915 6:88564143-88564165 CGGAGCAAAGGCCCTGAGGTGGG - Intergenic
1011662772 6:89608606-89608628 GAGGGCAAAGCCACTGAGGTGGG - Intronic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1012840835 6:104326985-104327007 AAGAGCAAAGGCCCTGAGGCCGG - Intergenic
1013292706 6:108732709-108732731 CAGGGCAAGGCCTCTGAGATGGG - Intergenic
1013608829 6:111775089-111775111 CAGAGGAAAGGCTGTGGGGTGGG + Intronic
1014478547 6:121905859-121905881 CATACCAAAGACTATAAGGTTGG + Intergenic
1014749292 6:125237021-125237043 TAGAGCAGAGACCCTAAGGTAGG + Intronic
1014925403 6:127265035-127265057 AACTGCAAAGACTATGAGGTTGG + Intergenic
1015074501 6:129139180-129139202 CAGAGTAAAGGCTCTGAGTCTGG - Intronic
1015143330 6:129959035-129959057 CAGAGAGGAGACCCTGAGGTGGG - Intergenic
1016213982 6:141573017-141573039 CAGTGCAAAGTCTCTGGGGAAGG + Intergenic
1016762314 6:147751111-147751133 CAGTGCAAAGGCCCTGAGATGGG - Intergenic
1017043411 6:150325578-150325600 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1017379761 6:153814355-153814377 CAGAACAAAGACTGTGTGTTTGG + Intergenic
1017752396 6:157500211-157500233 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1018605930 6:165597862-165597884 CAGAAAAAAGACTGTGAGGCTGG + Intronic
1018668505 6:166161374-166161396 CAGAGGCTAGACTCTGAGGCAGG - Intronic
1018778875 6:167044559-167044581 AACAGCAAGGCCTCTGAGGTAGG + Exonic
1019217786 6:170454759-170454781 AAGAGAAAAGAGGCTGAGGTGGG - Intergenic
1019551386 7:1604374-1604396 CAGAGCCGAGGCCCTGAGGTGGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020360658 7:7323539-7323561 AAGTACAAACACTCTGAGGTGGG + Intergenic
1020569448 7:9840251-9840273 AACAGCACAGACTTTGAGGTTGG - Intergenic
1020909613 7:14112111-14112133 CAATGCAAAGGCTCTGATGTGGG - Intergenic
1021075089 7:16293405-16293427 CAGAGAATAGACTCTAAGATTGG - Intronic
1021125217 7:16844356-16844378 AAGTGCAAATAATCTGAGGTAGG + Intergenic
1021225136 7:18017913-18017935 AAGAGCAAAGGCTTTGAGGTGGG - Intergenic
1021377298 7:19923787-19923809 AAATGCAAAGCCTCTGAGGTAGG + Intergenic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1022845861 7:34209245-34209267 CTGAGAAAGGACCCTGAGGTGGG - Intergenic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1024343812 7:48292637-48292659 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1024395350 7:48859975-48859997 CAGAGCCATGACACAGAGGTTGG + Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1025256292 7:57385772-57385794 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1025292214 7:57739896-57739918 AAGAACAAAGACTCAGAGGCAGG - Intergenic
1026382453 7:69813180-69813202 TAATGCAAAGACTCTGAGTTGGG - Intronic
1026444124 7:70469430-70469452 AAGAGCAAAGGCCCTGAGGCTGG + Intronic
1026683730 7:72490503-72490525 CATATCAAACACTTTGAGGTAGG - Intergenic
1027251902 7:76404141-76404163 AAGAGCTAAGAGTCTGAGTTTGG - Intronic
1027382394 7:77624835-77624857 AAAAGCAAAAACTCTGAGGTGGG + Intronic
1028233765 7:88335980-88336002 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1028872851 7:95787952-95787974 AGGTGCAAAGACCCTGAGGTGGG + Intronic
1030385680 7:108865207-108865229 CAATGCAAAGACTTTGAGATAGG - Intergenic
1030940902 7:115648549-115648571 AACAGCAAAGACTCTAGGGTGGG - Intergenic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1031976040 7:128094223-128094245 CAGAGAAAAAACTCAGAAGTGGG - Intergenic
1032142885 7:129349804-129349826 CAGAGAAAAGACCTTGAGATGGG - Intronic
1032257199 7:130306624-130306646 GAGAGCAGAGCCTCTGAGGGTGG + Intronic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1033266984 7:139895193-139895215 CAGAGAAAAGCCCTTGAGGTGGG + Intronic
1033267866 7:139901663-139901685 CAGACCAGAGTCTCTGGGGTGGG - Intronic
1033304992 7:140218687-140218709 CAGAGATAGGACTCTGGGGTGGG + Intergenic
1033399409 7:141007653-141007675 CACAGCAAAGGCCTTGAGGTGGG - Intronic
1033421486 7:141208303-141208325 GAGAGCAGAGACTCTGGGCTGGG + Intronic
1033830286 7:145243078-145243100 AATTGCAAAGGCTCTGAGGTAGG - Intergenic
1033965064 7:146965284-146965306 CAGCCCAAAGACTGTGAGATGGG - Intronic
1034081164 7:148278934-148278956 CAGTCCAAAGGCTGTGAGGTAGG + Intronic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1035485857 7:159225457-159225479 CATAGCAGACACTCTTAGGTTGG - Intergenic
1037737539 8:21579614-21579636 CAGAGAAGAGACTCTGAGCTGGG - Intergenic
1037839283 8:22232411-22232433 CAAAGCAAAGACTCTGATTGGGG + Intergenic
1037924922 8:22836684-22836706 CACAGCACAGACTTTGAGGAGGG - Intronic
1038645057 8:29354043-29354065 CAGAGCAGTGAGTCAGAGGTTGG - Intergenic
1038780304 8:30564346-30564368 CAGAGAAAGGTCTCTGAGGAGGG - Intronic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039119109 8:34126048-34126070 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1040023851 8:42763939-42763961 CAGAGCAAAGTCTGGGAGGAAGG + Intronic
1040593621 8:48818228-48818250 CTGAGCCATGACTCTGACGTTGG + Intergenic
1041569150 8:59316938-59316960 AAGTGCAAAGCCCCTGAGGTAGG - Intergenic
1041780024 8:61567991-61568013 AAGAGCAAAGGCTTGGAGGTAGG + Intronic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1043082504 8:75784326-75784348 CAGAGGAAAGACCCTGGAGTGGG + Intergenic
1043758339 8:84031967-84031989 CAGAGAGGAGACTCTGTGGTCGG - Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1044958113 8:97503098-97503120 CAGAGCAAGGGGTCTGGGGTGGG - Intergenic
1044966101 8:97575425-97575447 TAGGGCAAAGGTTCTGAGGTGGG + Intergenic
1044988129 8:97773194-97773216 CAAAGCCAAGAATCTGAGATAGG - Intergenic
1045181003 8:99782593-99782615 CAGAGGGAAGGCTCTGAGGCAGG + Intronic
1045254254 8:100506401-100506423 TAGAGCAGAGGCTCTCAGGTGGG - Intergenic
1045301835 8:100917873-100917895 CAAAACAAAGAATCTCAGGTTGG + Exonic
1045376847 8:101582712-101582734 CTCTGCAAAGACGCTGAGGTGGG - Intronic
1045748930 8:105458769-105458791 AAGAGCAAAGACTCTGAAGATGG - Intronic
1045820092 8:106326696-106326718 CAGTGCAAGGACCATGAGGTGGG + Intronic
1047275164 8:123400287-123400309 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1047566184 8:126046770-126046792 CTGTGCAAAGATTCTGGGGTGGG - Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1047724514 8:127672240-127672262 CAGTGCATAGGCCCTGAGGTGGG - Intergenic
1047855120 8:128901079-128901101 TAGAGCAAACCCTTTGAGGTTGG - Intergenic
1048221201 8:132543711-132543733 GAGAGCAAAGGCCCTGTGGTGGG - Intergenic
1048319337 8:133386221-133386243 CTGAAGACAGACTCTGAGGTAGG - Intergenic
1048364224 8:133724287-133724309 TAGTGCAAAAACTCTGAGGCAGG - Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1050085792 9:1964441-1964463 CTGAGCAAAGACCCCGGGGTGGG + Intergenic
1050163021 9:2737540-2737562 CAGGGCGACGATTCTGAGGTTGG - Intronic
1051042299 9:12826193-12826215 AAATGCAAAGATTCTGAGGTAGG - Intergenic
1052023096 9:23546825-23546847 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1052319898 9:27156546-27156568 AACAGCAAAGGCTTTGAGGTAGG + Intronic
1053255486 9:36613730-36613752 TAGAGCAAAGACTGGGAGGTAGG + Intronic
1054164280 9:61705812-61705834 AAGAACAAAGACTCAGAGGCAGG + Intergenic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1055493320 9:76828252-76828274 CTGTGCAAAGGCACTGAGGTGGG + Intronic
1055971734 9:81918790-81918812 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055973486 9:81933862-81933884 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055975240 9:81948954-81948976 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055980274 9:81994118-81994140 CAGTGAAATGGCTCTGAGGTTGG - Exonic
1056925773 9:90833396-90833418 CAGAACTAAAACTCTAAGGTGGG + Intronic
1057960725 9:99454194-99454216 CAGTGCAAAGGCTGTCAGGTGGG + Intergenic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1058891506 9:109365181-109365203 GTGAGCAAATACCCTGAGGTGGG + Intergenic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1058970125 9:110073722-110073744 CAGAGAAAAGACTCTGGGGAGGG - Intronic
1059334974 9:113563344-113563366 CAGAGCATAGACTCTGTGCCAGG - Intronic
1059499194 9:114736609-114736631 AAAAGCATAGACTCTGAAGTTGG + Intergenic
1059650077 9:116307931-116307953 CAGAGAAAACACTCTGTGCTGGG + Intronic
1059687756 9:116653853-116653875 CAGATCAAAGGCTCTGGGGGAGG + Intronic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1060290566 9:122299003-122299025 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1060383791 9:123203557-123203579 AAGTGGAAAGGCTCTGAGGTGGG - Intronic
1060835818 9:126754582-126754604 CTGTGCAAAGACTCAGAGGAGGG - Intergenic
1060975864 9:127764610-127764632 AAGTGCAAAGACCCTGAGGTGGG - Intronic
1061671893 9:132193478-132193500 AGGAGCACAGGCTCTGAGGTGGG + Intronic
1061750425 9:132773191-132773213 CAGTGCAAAGGCCCTGAGTTAGG - Intronic
1061876875 9:133548474-133548496 CAGAAAATAGACTCTGAGGTGGG + Intronic
1062695482 9:137873687-137873709 CAGCAGAAGGACTCTGAGGTTGG + Intergenic
1203519762 Un_GL000213v1:34519-34541 TAGACCAAGGACTCTGTGGTGGG - Intergenic
1185477486 X:424177-424199 GTGTGCAAAGACTCTGAGCTGGG + Intergenic
1185748603 X:2592301-2592323 CAAAGAATAGACGCTGAGGTGGG - Intergenic
1186092299 X:6062956-6062978 CAGTGCCAAGGCTCTGGGGTAGG - Intronic
1186217122 X:7312176-7312198 TAACACAAAGACTCTGAGGTGGG - Intronic
1186501415 X:10053699-10053721 CAGATTGAAGACTCTGAGGCTGG + Intronic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1186730377 X:12403322-12403344 AAGCTCAAAGACCCTGAGGTAGG - Intronic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1187620020 X:21041924-21041946 AAGTGCAAAAAATCTGAGGTTGG - Intergenic
1188286084 X:28326995-28327017 AAGTGCAAACTCTCTGAGGTGGG - Intergenic
1189305782 X:39985683-39985705 CAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1189327377 X:40121003-40121025 CAGTGCAAAGGCCCTGTGGTAGG + Intronic
1189551343 X:42096723-42096745 GAGAGCAAACACTTTGAGGGAGG - Intergenic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1190060069 X:47205157-47205179 CTGCGCAAAGATCCTGAGGTGGG + Intronic
1190221794 X:48516677-48516699 CAGTGGAAAGGCCCTGAGGTAGG + Intronic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1190525678 X:51327375-51327397 TAGAGCAAAGGCCCTGAGGAGGG + Intergenic
1190543808 X:51504297-51504319 TAGAGCAAAGGCCCTGAGGAGGG - Intergenic
1190711544 X:53075180-53075202 CAGAGCAAAGGCCCTGAGGTGGG - Intronic
1191666062 X:63703918-63703940 CAGTGCAAAGGCTCTAAGGGAGG + Intronic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1191983798 X:66956529-66956551 CAGATCTAAGATTTTGAGGTGGG + Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1192483310 X:71503545-71503567 AACAGCAGAGACTCTGAGGAAGG - Intronic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193554178 X:82932817-82932839 GAGAGAGAAGACTCTGGGGTGGG - Intergenic
1195731527 X:107973175-107973197 TAGCGCAAAGTCTCTGAAGTAGG + Intergenic
1197809515 X:130428969-130428991 AAGTGCAAAGACCCTGAGGTGGG + Intergenic
1197890539 X:131265725-131265747 TAAATCAAAGTCTCTGAGGTTGG - Intergenic
1198453846 X:136795697-136795719 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1198632126 X:138652160-138652182 CAGTTCAAAGAGTCAGAGGTGGG - Intronic
1198657109 X:138926619-138926641 CAGTGCAAAGGCTCTAATGTAGG + Intronic
1198691911 X:139293716-139293738 CAGAACAAAAACACTGAGGCAGG - Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1201228698 Y:11843045-11843067 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic