ID: 1134041983

View in Genome Browser
Species Human (GRCh38)
Location 16:11076061-11076083
Sequence TAGAATCCCCACCAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134041983_1134041988 -6 Left 1134041983 16:11076061-11076083 CCCTGCAGCTGGTGGGGATTCTA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1134041988 16:11076078-11076100 ATTCTAGAAAACTGGGACTAGGG 0: 1
1: 0
2: 2
3: 27
4: 289
1134041983_1134041989 -5 Left 1134041983 16:11076061-11076083 CCCTGCAGCTGGTGGGGATTCTA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1134041989 16:11076079-11076101 TTCTAGAAAACTGGGACTAGGGG 0: 1
1: 0
2: 0
3: 30
4: 458
1134041983_1134041987 -7 Left 1134041983 16:11076061-11076083 CCCTGCAGCTGGTGGGGATTCTA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1134041987 16:11076077-11076099 GATTCTAGAAAACTGGGACTAGG 0: 1
1: 2
2: 0
3: 53
4: 497
1134041983_1134041990 -4 Left 1134041983 16:11076061-11076083 CCCTGCAGCTGGTGGGGATTCTA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1134041990 16:11076080-11076102 TCTAGAAAACTGGGACTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134041983 Original CRISPR TAGAATCCCCACCAGCTGCA GGG (reversed) Intronic
900207767 1:1438912-1438934 GAGAATCCCCAGCATCTGCGGGG + Intronic
900605261 1:3521021-3521043 TAGACTCCCCACTAGCAGCTTGG - Intronic
900763599 1:4488796-4488818 GAGCTTCCCCACCAGCTCCATGG - Intergenic
904796667 1:33061408-33061430 GAGAGTCCCCACCAGCAGAAAGG + Intronic
905782103 1:40720931-40720953 TTGAATCCCCACTATGTGCAAGG + Intronic
906105910 1:43292339-43292361 TAGAAGTCCCATCTGCTGCAGGG - Intergenic
908303925 1:62791538-62791560 CAGAATCCCCACCAGCAAGAAGG - Intronic
911364382 1:96919350-96919372 TAGACTTCCCTCCAGATGCAGGG + Intergenic
914499660 1:148234310-148234332 AAGAACCCTCACCAGCTGGAAGG + Intergenic
915658749 1:157383360-157383382 CAGAATCCCCACCAGCAAGAAGG + Intergenic
916608705 1:166368578-166368600 TTGAATCCCCACTAGGTACAAGG + Intergenic
916725197 1:167517194-167517216 CAGAAACCCCTGCAGCTGCACGG + Intronic
919510480 1:198457278-198457300 CAGAATCCCCACCAGCAAGAAGG - Intergenic
919591372 1:199507891-199507913 TCTAATCCCCACCTTCTGCATGG + Intergenic
919786791 1:201263177-201263199 CAGTTTCCCCACCAGCTGCTGGG - Intergenic
924472082 1:244351390-244351412 TAGAATCTCCACCACCACCATGG - Intergenic
924524151 1:244831882-244831904 TACATTCCCCACCAACTGTATGG - Intergenic
1067797123 10:49328677-49328699 TAGAAACCTCAGCAGCTGCCAGG + Intergenic
1070029879 10:72666720-72666742 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1070081572 10:73193918-73193940 GAGAATCCCCACCAGCAAGAAGG - Intronic
1071490625 10:86134165-86134187 TGGAATGCCCACCAGTGGCATGG + Intronic
1073604467 10:104879975-104879997 TGGAATCCCCAGCAGCTCCAAGG - Intronic
1075056631 10:119223499-119223521 CAGAAAACCCACCAGCTCCAGGG - Intronic
1076170363 10:128314292-128314314 TCTAATCCCCACCAAATGCATGG + Intergenic
1078901187 11:15644216-15644238 TATAAACTCCACTAGCTGCAAGG - Intergenic
1080551019 11:33374246-33374268 TGGGATCACCACCGGCTGCAGGG + Intergenic
1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG + Intergenic
1083176104 11:60951420-60951442 CAGCATCTCCACCAGCAGCACGG + Exonic
1084795283 11:71501164-71501186 CAGAGTCCCCACCAGATGCTGGG - Intronic
1086329900 11:85743691-85743713 GAGAATACCCACCAGCCCCACGG + Intronic
1088181365 11:107116231-107116253 CATAATCCACACCTGCTGCAGGG + Intergenic
1089777495 11:120848532-120848554 AAGAATCACCCCAAGCTGCATGG + Intronic
1090544075 11:127743404-127743426 TAGAGTCCCCACCAGCAAGAAGG - Intergenic
1090899274 11:131012674-131012696 TGAAATCCCCACCAGATGAAAGG + Intergenic
1091011514 11:132005601-132005623 TAGAATCCCCACTATCTGTCAGG - Intronic
1091287159 11:134413825-134413847 TAGACTCCACACCAGCTGAAGGG + Intergenic
1091352941 11:134912285-134912307 TAGAGTGACCACCAGCAGCAAGG - Intergenic
1092763969 12:11836090-11836112 TAGAATTGCCTCCAGGTGCAAGG + Intronic
1093435641 12:19130841-19130863 TAAAGTCCCCGCCAGCCGCACGG + Intronic
1097028085 12:56073025-56073047 TAGACACCCCACCAGCAGCCAGG - Intergenic
1097934730 12:65233610-65233632 TAGAATATTCACCAGCTGGAAGG + Intronic
1098175629 12:67787451-67787473 TAGAGTCCCCTCCAGCAGGAAGG + Intergenic
1099406521 12:82270316-82270338 TTGAATTCCCACCACCTGCTTGG + Intronic
1104077187 12:125400533-125400555 TGGAGTCCCCACCTGCTCCATGG + Intronic
1104487794 12:129166866-129166888 TAGAAACCACACCAGTTGCTGGG + Intronic
1104588721 12:130067685-130067707 TAGAGGCCCCACCAGCAGGAAGG - Intergenic
1105999894 13:25711927-25711949 TAGAATTACCACCAGCTGCTGGG + Intronic
1106188524 13:27429057-27429079 TAGAAGCCCCCCTAACTGCAGGG - Intronic
1106194362 13:27480670-27480692 GAGAATCCCCACCAGCAGGAAGG + Intergenic
1107193686 13:37621602-37621624 CAGAATCCCCACCAGCAAAAAGG + Intergenic
1108298571 13:49051506-49051528 CAGAATCCCTACAAGCTACAAGG - Intronic
1108458731 13:50643725-50643747 GAGAGTCCCCACCAGCAGGAAGG - Intronic
1111679133 13:91422715-91422737 CAGAGTCCCCACCAGCAGGAAGG - Intronic
1112945484 13:104921629-104921651 TAGAAACCCTACAAGCTGGAAGG + Intergenic
1114929159 14:27445797-27445819 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1116659364 14:47689207-47689229 TCCAACCCCCACCAGCAGCAGGG - Intergenic
1118013803 14:61637849-61637871 AAGAATCCACAGCAGCTCCAGGG - Intronic
1122050939 14:99059267-99059289 TGGATTCCCTACCAGCTGCAGGG - Intergenic
1127765103 15:62178112-62178134 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1130134234 15:81168600-81168622 TAGAATCTCCAGAAGATGCACGG - Intronic
1130371155 15:83285683-83285705 AAGGATCCCCACCAGCAGCAAGG - Intergenic
1130713810 15:86311838-86311860 GAGAATTTCCACCAGCTGCAAGG - Intronic
1130989720 15:88869140-88869162 TAGTCTCCCCACCAGCCGCCTGG + Intronic
1132333213 15:101026658-101026680 AACAATCCCCACAACCTGCAGGG - Intronic
1132851929 16:2028710-2028732 AAGGCTCCCCACCAGCTGCCGGG - Intronic
1134041983 16:11076061-11076083 TAGAATCCCCACCAGCTGCAGGG - Intronic
1135751679 16:25063336-25063358 AAAAATCCCCAGCAGCTGCGTGG - Intergenic
1135758444 16:25117325-25117347 TTGATTCCCCATCAGCTGCAAGG + Intronic
1137480583 16:48848947-48848969 TGGGATCCCCACCAGCAACAAGG - Intergenic
1137519518 16:49180111-49180133 TAGACTCCCCACACACTGCATGG + Intergenic
1140479394 16:75254224-75254246 TAGATTCCCTTCCTGCTGCAGGG - Intronic
1141295837 16:82768137-82768159 TAGCATTCCCACCAGCCACAAGG - Intronic
1141863763 16:86735820-86735842 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1148964023 17:51419539-51419561 CAGAGTCCACACCTGCTGCAAGG - Intergenic
1149187000 17:54009826-54009848 TAGAATCGCAATCAGTTGCAAGG - Intergenic
1158844516 18:61427773-61427795 TAGAATCCCCTCCAGCTCTGTGG + Intronic
1159121797 18:64179603-64179625 TATACTCCCCATCAGCAGCAGGG + Intergenic
1159374868 18:67580199-67580221 CAGAATCCCCGCCAGCAGGAAGG + Intergenic
1159407950 18:68030707-68030729 TAGAATCCCTACCAGAGGAAAGG + Intergenic
1160486042 18:79293556-79293578 GAGAGTCCCCACCAGCAGAAAGG + Intronic
1161068515 19:2249538-2249560 TAGAGCCCCCACCACCCGCAGGG - Exonic
1161115271 19:2493226-2493248 TAGAATCCCCATCAGAGGCTGGG - Intergenic
1161462036 19:4403178-4403200 CAGTTTCCCCACCCGCTGCAAGG - Intronic
1162195789 19:8983576-8983598 CAGAGTCCCCACCAGCAACAGGG + Intergenic
1162315512 19:9936190-9936212 CACAAGCCCCCCCAGCTGCAGGG - Intronic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
1164633263 19:29775360-29775382 CAGAGTCCCCACAGGCTGCAGGG - Intergenic
1165402459 19:35610501-35610523 TAGCATGCCCACCAGCTTCCAGG - Intergenic
1167683910 19:50943586-50943608 CGGCATCCCCACCTGCTGCAGGG - Exonic
928218977 2:29386971-29386993 TAGAATTGCCACCAGCCGAAGGG - Intronic
928388965 2:30894579-30894601 GAGAATTCCCAGCAGCTGAAGGG + Intergenic
929586801 2:43121353-43121375 TAGAATCTCCAGAAGCTGCTAGG + Intergenic
929669711 2:43864573-43864595 TAGAATTCTCACCATCTGCATGG + Intronic
929669724 2:43864741-43864763 TAGAATTCTCACCGTCTGCATGG + Intronic
929669746 2:43865121-43865143 TAGAATTCTCAGCATCTGCATGG + Intronic
929669748 2:43865205-43865227 TAGAATTCTCACCATCTGCATGG + Intronic
929669943 2:43867520-43867542 TAGAATTGTCACCATCTGCATGG + Intronic
931688560 2:64815773-64815795 TAGCATCCCCTGCAGCTGAAGGG + Intergenic
934856451 2:97733117-97733139 CAGATACTCCACCAGCTGCAGGG - Exonic
937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG + Intronic
937232093 2:120404164-120404186 TCCAATCCCCACAAGCTCCAGGG - Intergenic
938078271 2:128353696-128353718 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
941641787 2:167996737-167996759 AAGAATCTCCACCAGTTTCAGGG - Intronic
944477251 2:200119474-200119496 TGGATTCCCAAACAGCTGCAGGG + Intergenic
945197053 2:207246497-207246519 AAGACTTCCCACCAGATGCATGG - Intergenic
946689069 2:222297507-222297529 TAGACTCTCTACCAGCTGCAGGG - Intronic
948673892 2:239585651-239585673 GAGACTCCCCACAGGCTGCAAGG - Exonic
1174151341 20:48488661-48488683 TGCAATCCCCACCAGATGTAAGG + Intergenic
1175286101 20:57837836-57837858 TAGACCCCCCAGCAGCTCCAGGG - Intergenic
1176049251 20:63107964-63107986 GAGCAGCCCCTCCAGCTGCAGGG - Intergenic
1176366161 21:6034121-6034143 CAGAACCCCCACTGGCTGCACGG - Intergenic
1178760109 21:35394028-35394050 TAGAGTCCCCACCAGCAAGAAGG + Intronic
1179651927 21:42816742-42816764 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1179757356 21:43504424-43504446 CAGAACCCCCACTGGCTGCACGG + Intergenic
1180108969 21:45638851-45638873 AAGAAAGCCCACCAGCTGCTGGG - Intergenic
1183395049 22:37566772-37566794 CAGCAGCCCCACCAGCTCCACGG + Exonic
1183603271 22:38852395-38852417 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
1185065669 22:48630697-48630719 TAGAAGCCACACAGGCTGCAGGG + Intronic
950327492 3:12125294-12125316 TAGAATCCTCAGCAGCTGGCTGG - Intronic
951665597 3:25119984-25120006 TAGAGTGCCCCCCAGCTCCAAGG + Intergenic
954807012 3:53226511-53226533 TGGAATCCTCACCAGCTTCCTGG + Intronic
955599019 3:60624381-60624403 TCAAATCCACACCAGCTGTAGGG - Intronic
958104238 3:89052524-89052546 TAAAATTCCCACCAGCGCCAAGG + Intergenic
959593906 3:108108080-108108102 TACAATCACCACAAGCTCCATGG + Intergenic
961063993 3:123858509-123858531 AAGAGTCCCCACCAGCAGGAAGG - Intronic
962284746 3:134076359-134076381 GAGAATCCCCACCATCTGCATGG - Intronic
962710456 3:138081532-138081554 AAGAAGCCCTGCCAGCTGCATGG + Intronic
964145997 3:153464136-153464158 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
964739284 3:159948675-159948697 CAGAATCCCCACCAGCAAGAAGG + Intergenic
966880137 3:184345421-184345443 TAGAATCACCCCCACCTGGAGGG + Intronic
968179882 3:196585857-196585879 AAGAATCCCGGCCAGCTGCTGGG - Exonic
969444753 4:7238406-7238428 TAGGAGCCCTACCAGCAGCATGG - Intronic
976607625 4:86997295-86997317 TAGAGTCCCCACCAGCAAGAAGG + Intronic
978774018 4:112487533-112487555 TAGAATCCTCTACAGCCGCAGGG + Intergenic
981380847 4:144069927-144069949 CAGAATCCCCACCAGCAACAAGG - Intergenic
984435895 4:179709778-179709800 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
987553449 5:19413643-19413665 TATAATCACCACAAGCTCCATGG - Intergenic
988711842 5:33786895-33786917 CAGAATCCCCACCAAAGGCAGGG - Intronic
988963278 5:36390796-36390818 TAGCCTCCCCACCAACCGCAGGG - Intergenic
991042466 5:62190228-62190250 TATAATCCCCACAAGTTGGAGGG + Intergenic
994778006 5:104060121-104060143 TAGAAACCCCACAAGCTAAAAGG - Intergenic
996548415 5:124705606-124705628 TATAATCCCCTCCAAATGCATGG + Intronic
1001092850 5:168754080-168754102 GAGAGTCCCCAGCAGCTGCAGGG - Intronic
1002792875 6:448503-448525 CAGAATCCCCACCAGCAAGAAGG + Intergenic
1003616417 6:7659020-7659042 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1004220080 6:13739143-13739165 TGGACCACCCACCAGCTGCATGG + Intergenic
1007144618 6:39615871-39615893 TAGTATACTCACCAACTGCATGG - Intronic
1007982563 6:46173963-46173985 CAGAATCCCCAGCAGCTGTTAGG - Intergenic
1008863927 6:56187137-56187159 GAAAACCCCCACCAGCTGTAAGG - Intronic
1009389550 6:63129521-63129543 CAGAAACCCTACCAGCTGGAAGG - Intergenic
1010583131 6:77623892-77623914 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1013583739 6:111560504-111560526 TAGAAGCAGCACCTGCTGCATGG + Intronic
1013652606 6:112211175-112211197 TGTAATCCAGACCAGCTGCATGG - Intronic
1015935055 6:138400798-138400820 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1017678463 6:156839527-156839549 TAGAATCCCCTTCAGCTGCCAGG + Intronic
1017941202 6:159054872-159054894 TTGAGTCCCCACAAGGTGCATGG + Intergenic
1021772624 7:24020431-24020453 GAGCATGCCCACCAGCTTCAAGG - Intergenic
1029503695 7:100949623-100949645 GAGGAGCCCCAACAGCTGCATGG - Exonic
1031744979 7:125484331-125484353 CAGAATCCCCACCAGCAAGAAGG - Intergenic
1033082250 7:138309316-138309338 GAGAATCTCCACCAGCAGGAAGG - Intergenic
1034492762 7:151402752-151402774 TAGAGTCCCAACCAGCTGGTGGG - Intronic
1035047681 7:155980040-155980062 CAGAGGCCACACCAGCTGCAGGG + Intergenic
1035879776 8:3233370-3233392 CAGAATCCCCACCAGCAAGAGGG + Intronic
1036470844 8:9051258-9051280 CAGAGTCCCCACCAGCAACAAGG - Intronic
1038448709 8:27624305-27624327 TAAAAGCCCAACCTGCTGCAGGG + Intergenic
1038691864 8:29771614-29771636 CAGAGTCCCCACCAGCAGGAAGG + Intergenic
1038989599 8:32853566-32853588 TAGAATTCCCCCCAACTTCATGG - Intergenic
1039577939 8:38639958-38639980 GAGAATCTCCACCAGCAGGAAGG + Intergenic
1043571826 8:81612499-81612521 AAGAATCCCCACCAGCAAGAAGG + Intergenic
1046524076 8:115361558-115361580 TAGATTCAGCTCCAGCTGCAAGG + Intergenic
1048307711 8:133295750-133295772 TATAATACCCATCAGCTGCACGG - Intronic
1049586200 8:143433479-143433501 AGGAAGCCCAACCAGCTGCAGGG - Intergenic
1058272933 9:102997597-102997619 TGGAATCTGCATCAGCTGCAGGG - Intronic
1189945844 X:46177918-46177940 TAGAAACCCTACAAGCTGGAAGG - Intergenic
1196120877 X:112049341-112049363 TGGAAGCACCACCAACTGCATGG + Intronic
1196881632 X:120204252-120204274 GAGAATCCCCACCAGCTAGAGGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic