ID: 1134042762

View in Genome Browser
Species Human (GRCh38)
Location 16:11080994-11081016
Sequence ATGCAGAAACTGGCAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134042756_1134042762 -8 Left 1134042756 16:11080979-11081001 CCCACCCCAGGTGGGATGCAGAA 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG 0: 1
1: 0
2: 4
3: 40
4: 356
1134042757_1134042762 -9 Left 1134042757 16:11080980-11081002 CCACCCCAGGTGGGATGCAGAAA 0: 1
1: 0
2: 1
3: 7
4: 165
Right 1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG 0: 1
1: 0
2: 4
3: 40
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134042762 Original CRISPR ATGCAGAAACTGGCAGCAGA TGG Intronic
900578847 1:3397754-3397776 TTGGAGAAACTTGCAGCAAATGG - Intronic
902710434 1:18235820-18235842 GGTGAGAAACTGGCAGCAGAGGG + Intronic
902799582 1:18820947-18820969 TTCCAGAAGCTGACAGCAGATGG - Intergenic
903528833 1:24013929-24013951 AGGCAGAAAGTGGCATGAGATGG + Intergenic
903651407 1:24924595-24924617 ATGCAGAAGCCCACAGCAGAGGG - Intronic
904313150 1:29642231-29642253 ATGAAGGAACTGTGAGCAGATGG + Intergenic
904432424 1:30473009-30473031 ATGTAGACACTGGCCGTAGAAGG - Intergenic
904555992 1:31364647-31364669 GAGCAGAGACTGGCAGCAGGAGG + Exonic
904609460 1:31717113-31717135 AGGCAGAAGCTAGCTGCAGAGGG + Intergenic
904883233 1:33716209-33716231 AACCAGAGACTGGTAGCAGAAGG + Intronic
905092820 1:35443026-35443048 ATGCTGAGAGTGGCAGCAAAGGG + Exonic
905851630 1:41279240-41279262 TTGAAGAGACTGGCAGGAGATGG + Intergenic
906148400 1:43573464-43573486 ATGCAGCATCTGGCTGCAGGAGG + Intronic
906728015 1:48058147-48058169 AGGGAGAAACAGGCAGGAGAGGG + Intergenic
907098416 1:51803552-51803574 GTGGAGAAACTGACAGCAAAGGG + Intronic
907406499 1:54256874-54256896 GTTCAGAAGGTGGCAGCAGATGG - Intronic
908459006 1:64331070-64331092 AGGCAGAACCAGGCAGCAGAGGG - Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909218622 1:72925688-72925710 TAGCAGAAAGTGGCAGCACAGGG + Intergenic
909503913 1:76365914-76365936 ATGTAGGAACTGGAAGGAGATGG - Intronic
910366612 1:86472106-86472128 ATGGAGAAATAGGCAGCAGCTGG - Intronic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
912688560 1:111786331-111786353 CTGCTGAAAATGGCAGGAGAGGG - Intronic
914251315 1:145924264-145924286 CAGCAGAAAGAGGCAGCAGAAGG - Intergenic
915759491 1:158296099-158296121 ATGCATGTACTGGCAGCAGTGGG - Intergenic
916280809 1:163049035-163049057 AGGCAGAACCTGGGAGCACAAGG + Intergenic
916339907 1:163721411-163721433 ATGTAGAAACTGGCACCACAAGG - Intergenic
917269761 1:173259494-173259516 ATGCATAAACTGACAGAAGTAGG + Intergenic
917856372 1:179103874-179103896 ATTAAGAAACTAGCAGAAGATGG - Exonic
918063835 1:181086079-181086101 ATGAAGAAACTGGCAGGGCATGG - Intergenic
920019743 1:202946452-202946474 ATACAGAAACTGGCAACATCTGG - Exonic
920263876 1:204707635-204707657 ATGCTGTAACTGGGAGCAGAGGG + Intergenic
920750755 1:208673623-208673645 ATGAATAAACTGGCAGCCAATGG - Intergenic
921359906 1:214321608-214321630 TGGCAGCAGCTGGCAGCAGAAGG + Intronic
921996063 1:221419550-221419572 CAGCAGAAAAAGGCAGCAGAAGG + Intergenic
922848049 1:228705609-228705631 AGGCAGAAACTGGCAGTAAATGG - Intergenic
923521633 1:234739435-234739457 AAGCAGCAAGGGGCAGCAGAAGG - Intergenic
924588842 1:245384019-245384041 ATACTGAAAGTGGCAGAAGAGGG - Intronic
924788069 1:247218962-247218984 ACGCAGAGACTGGCAGAAAATGG + Intergenic
924804949 1:247354640-247354662 ACGCAGAGACTGGCAGAAAATGG + Intergenic
924947299 1:248855265-248855287 ATTCAGAACCAGGAAGCAGAGGG - Intronic
1062847695 10:720309-720331 ATCCAGAAACTGCCTGCAAAGGG + Intergenic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063566600 10:7176838-7176860 TTGCAGACACTGGCAGCAAGTGG + Intronic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1064779284 10:18816686-18816708 ATGTAGAAAGTGGCTGGAGATGG + Intergenic
1065120514 10:22525787-22525809 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1065120885 10:22529733-22529755 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1065841055 10:29701365-29701387 ATGATGAAGCTGGCTGCAGATGG - Intronic
1067343247 10:45420777-45420799 ATGGAAAAGCTGGTAGCAGAAGG + Intronic
1068396800 10:56472570-56472592 AGGCAGAAACTGGAGGGAGATGG + Intergenic
1069858089 10:71452603-71452625 ATGCAGACAAAGCCAGCAGAAGG - Intronic
1070727797 10:78803897-78803919 ATGCAGCCTCTGGCAGAAGAAGG - Intergenic
1071061493 10:81575212-81575234 GTGAGGAACCTGGCAGCAGATGG - Intergenic
1071672756 10:87624878-87624900 AGGCAGAAACTGGCAGTAGATGG + Intergenic
1071823168 10:89298165-89298187 ATGCTGATAGTGGCAGCAGTGGG - Intronic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1072731751 10:97850902-97850924 AGGCAGAAACTCCCATCAGATGG - Intronic
1072745724 10:97937884-97937906 ATGCAGATACTGCCTCCAGAGGG + Intronic
1072763539 10:98078204-98078226 GTGAAGAAACTGGCAGGAGATGG + Intergenic
1072917259 10:99545775-99545797 AGGCAGAAACTGACAGAAAAAGG - Intergenic
1073345151 10:102777275-102777297 ACCCAGGAACAGGCAGCAGAGGG - Intronic
1074289182 10:112125526-112125548 ATGCAGATTCTGACCGCAGAGGG - Intergenic
1074818969 10:117165266-117165288 ATGCAGAAGCAGTGAGCAGACGG - Intergenic
1075532167 10:123238824-123238846 GTGCAGAGACTGGGGGCAGAGGG - Intergenic
1075827737 10:125374242-125374264 GTGCAGACACTGGGAGAAGACGG - Intergenic
1076204055 10:128581288-128581310 GAGAAGAAACTGGCAGCTGATGG + Intergenic
1076573993 10:131451900-131451922 CTGCAGAAGCTGGCAGCACAGGG - Intergenic
1076738776 10:132470708-132470730 AGGGAGGAACTGGCAGGAGATGG - Intergenic
1077187430 11:1241605-1241627 GTGCAGGAACTGGGAGCAGGAGG + Exonic
1077544984 11:3165290-3165312 CTGCAGGAAATGCCAGCAGATGG + Exonic
1077793055 11:5461849-5461871 ATGCTGAAACAGGCAGAAGCTGG - Intronic
1077980933 11:7300342-7300364 ATGCAGAATGTGGGAGCACAAGG + Intronic
1078187476 11:9064804-9064826 ATCCAGAAACTGTCAAAAGATGG + Intronic
1078556538 11:12331457-12331479 ATGCACAAAGTGCCAGCAGGTGG + Intronic
1079645254 11:22856125-22856147 TTGCAGAAAATAGAAGCAGAGGG + Intronic
1080653649 11:34242011-34242033 ATGCAGAAGCTGCGAGGAGATGG + Intronic
1081090014 11:38852787-38852809 AAGCTGAAACTGACAGCAGATGG - Intergenic
1081837032 11:46164419-46164441 GTACAGAAAGTGGCAGCAGACGG + Intergenic
1083721373 11:64605251-64605273 ATGCAGAATCGGGCAGTGGAGGG + Intergenic
1084068784 11:66720553-66720575 CTGCAGAAACCAGCAGCAGCGGG + Intronic
1084675394 11:70630991-70631013 AGGGAGCAACTGGCAGCAGAGGG + Intronic
1084927557 11:72525633-72525655 ATGCAGAACCAGGCACCAGGCGG - Intergenic
1085758839 11:79224456-79224478 ATGCAAAAACTGAGAGCAGTTGG + Intronic
1088112222 11:106275735-106275757 ATGCAGAAATTTTCAACAGAAGG - Intergenic
1089337782 11:117736912-117736934 GAGCAGAAACTGGGAGCCGAAGG - Intronic
1090734554 11:129599472-129599494 ATGGACAAACTGACAGGAGAAGG + Intergenic
1091237469 11:134031662-134031684 ACGCAGAAAGTGGCAACTGAGGG - Intergenic
1092707955 12:11305179-11305201 ATGATGAAACTGGCTGCAGTAGG + Intergenic
1093473831 12:19533496-19533518 ATGCAGGAACTCGAAGAAGAAGG + Intronic
1093662887 12:21776888-21776910 ATTCTGTAACTGGCAGAAGAGGG + Intergenic
1094431923 12:30379518-30379540 ATGTATAAACTGTCAGAAGAAGG - Intergenic
1097072016 12:56361999-56362021 GTGCAGAAATTGGCAGGACAAGG + Exonic
1099491895 12:83299005-83299027 TTGCATAAACTGAGAGCAGAAGG + Intergenic
1100283023 12:93136767-93136789 TTACAAAAACAGGCAGCAGATGG - Intergenic
1101938603 12:109081865-109081887 ATACTGAAACTGTTAGCAGATGG - Intronic
1105883824 13:24625647-24625669 AAACAGAAACAGGAAGCAGAAGG - Intergenic
1106281660 13:28279245-28279267 ATGCAGTAACACGCAGCAGAAGG - Intronic
1108405164 13:50093550-50093572 AGGCAGATACTGTCAGCAAAGGG + Intronic
1109006036 13:56878058-56878080 ATGAAAAAACTGGCAAAAGAAGG - Intergenic
1109287991 13:60434738-60434760 AAGAAGAAACTGACACCAGAGGG - Intronic
1109340211 13:61047614-61047636 ATTCAAAAACTGGGAGAAGATGG + Intergenic
1109548542 13:63860814-63860836 ATGCTGGAAGTGGCAGCAGTGGG - Intergenic
1113117831 13:106892525-106892547 TTGGAGAAACTGGCAACAAAAGG + Intergenic
1113274974 13:108718525-108718547 ATGCAGCAGCAGGAAGCAGAAGG + Intronic
1113590141 13:111492966-111492988 ATGCAGAAACTGCAATCAGGAGG + Intergenic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1117889245 14:60399878-60399900 CAGCAGAAAGAGGCAGCAGAAGG + Intronic
1118621514 14:67618669-67618691 AAGAAGAAACTGGCTGCACATGG - Intergenic
1120434357 14:84461886-84461908 ATGCAGATTCTGGTATCAGATGG + Intergenic
1121528174 14:94633796-94633818 ATACAGAAACCGGCAGCAGCCGG + Intergenic
1122754927 14:103970958-103970980 ATGCAGAATCTGGATACAGAGGG + Intronic
1122845481 14:104494699-104494721 ATGAAGGAACTGGAAGCTGATGG + Intronic
1202840115 14_GL000009v2_random:114031-114053 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1202909498 14_GL000194v1_random:104228-104250 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1123901921 15:24885959-24885981 ATGCAGAAACAGAAACCAGACGG - Intronic
1123979702 15:25589463-25589485 ATCCAGGAACAGGCAGCAGCAGG - Intergenic
1124381731 15:29172997-29173019 AGGCAGAAATAGGCTGCAGAGGG - Intronic
1124421498 15:29527021-29527043 AAGCAGAAAATATCAGCAGAAGG - Intronic
1125385311 15:39130676-39130698 ATGAAGAAACAGGAAGCAGCTGG + Intergenic
1126273710 15:46850662-46850684 AAGCAGAAAGTGGCAGCACAGGG - Intergenic
1126814330 15:52439755-52439777 ATGTAGAAACTGGTAGGAGAAGG + Intronic
1127089915 15:55457020-55457042 AAGCAGAAATTGGTGGCAGAGGG + Intronic
1127821142 15:62657181-62657203 ATGGAGAAACTGGGAGGAGGAGG + Intronic
1131687076 15:94779605-94779627 ATAAAGAAACTGTCAGCACAGGG + Intergenic
1131894588 15:97012620-97012642 ATGCAGAAAGGGGAAGCGGAAGG - Intergenic
1133125842 16:3645543-3645565 ATGCAGAAAGCGGCAGCACTGGG + Intronic
1133393818 16:5430235-5430257 TTGCAGGAAATGGCAGCAGGTGG + Intergenic
1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG + Intronic
1134313709 16:13099086-13099108 TTGCAAAAACAGGCAGCAGCTGG - Intronic
1135627728 16:24010775-24010797 ATGAAGTCACTGGCAGCAGCAGG - Intronic
1135743731 16:24998301-24998323 AAGAAGAAACAGGCAGCAGATGG + Intronic
1137754643 16:50891730-50891752 CTCTAGAAACTGGGAGCAGAGGG + Intergenic
1137906650 16:52330147-52330169 ATGCAGAAACGTGAAGCAGAGGG - Intergenic
1137967803 16:52953772-52953794 CTGAAGAAGCTGGGAGCAGAAGG + Intergenic
1137992871 16:53177839-53177861 ATCCAGAATCTGGCAGAAGCAGG + Intronic
1139832709 16:69812946-69812968 ATGCAGAAACTAGCAGGTGAAGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142874754 17:2844957-2844979 CTGCAGAAACTGGCAGGGGTTGG - Intronic
1143260945 17:5597845-5597867 ATGCAGGAAGAGGAAGCAGAGGG + Intronic
1143322951 17:6079922-6079944 ATGAGGAAACTGGCAAAAGAAGG - Intronic
1143621850 17:8085323-8085345 ATGCAAAAACTAGCATCAGGAGG + Intronic
1144086805 17:11816743-11816765 ATACAGAAGATGGCAGAAGATGG + Intronic
1144115481 17:12085747-12085769 CTGCTGATACTGTCAGCAGAGGG - Intronic
1144439115 17:15265487-15265509 ATGGAGAAACTGGAATCAGAAGG + Intergenic
1144792444 17:17868128-17868150 ATGGAGAAACTGGAATCACATGG + Intronic
1144815593 17:18032262-18032284 AGGCAGGAACTGCCAGCACAGGG + Intronic
1145942263 17:28748788-28748810 AGGCTGGAGCTGGCAGCAGAGGG - Intronic
1146603998 17:34242497-34242519 TTGCAGAAAATGGAAGGAGAGGG + Intergenic
1146696294 17:34911199-34911221 ATACAGAACATGGCAGGAGATGG + Intergenic
1153396716 18:4630306-4630328 ATGCAGAAGCTGGAAGCAGAAGG + Intergenic
1153587390 18:6637133-6637155 ATTCTAAAACTGGCTGCAGAGGG - Intergenic
1155188974 18:23412729-23412751 TTTCAGAAACAGGCAGCAGGTGG - Intronic
1155566306 18:27138407-27138429 ATGTAGAAGCTGGCAGGAGAAGG - Intronic
1155800402 18:30094735-30094757 ATGAAGAAACAGGAAACAGATGG - Intergenic
1158158667 18:54455114-54455136 ATACAGATACAGGCAGGAGAGGG + Intergenic
1158513685 18:58113618-58113640 GTGCAGAGACTGCCAGAAGAGGG + Intronic
1158937641 18:62379344-62379366 ATTCAGCAGGTGGCAGCAGAAGG - Intronic
1159362063 18:67418286-67418308 AAGGAGAAACTCACAGCAGAAGG - Intergenic
1160241313 18:77125010-77125032 GTGCAGAAACGGGCAGGAGCCGG - Intronic
1160761097 19:784902-784924 ATGCAGGAGCTGGTAGCTGAGGG - Intergenic
1160910882 19:1473361-1473383 AAGCAGAAACTGGGGGCACAGGG + Exonic
1162656771 19:12137362-12137384 ATGCAGGAACTGGGAGGAGGTGG - Intronic
1163512495 19:17743993-17744015 ATGCAGAAACTTCCAGGAAAAGG + Intergenic
1164475457 19:28572524-28572546 ATGGTGAAACTGGTATCAGAGGG - Intergenic
1164691022 19:30210829-30210851 ATGCAGAAACTGAGAGCTCAGGG - Intergenic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1168069438 19:53941708-53941730 ATGCAGACTCTGGCGTCAGAGGG + Intronic
1168491371 19:56813463-56813485 ATGCAGACACTGACATCTGAAGG + Exonic
929544574 2:42847348-42847370 AGGAAGAAACTGGAAGCAGAAGG - Intergenic
930227424 2:48808218-48808240 TTCCAAAAACAGGCAGCAGATGG + Intergenic
930479420 2:51927361-51927383 AGGCAGCAAAAGGCAGCAGAAGG - Intergenic
931625098 2:64250299-64250321 AAGCAGACAATAGCAGCAGATGG + Intergenic
931707889 2:64962600-64962622 AAGAAGAAGCAGGCAGCAGAAGG - Intergenic
932003782 2:67907830-67907852 ATGCAGAGCCTGGCAGATGATGG + Intergenic
932365572 2:71150881-71150903 CTGCAGAAGCTGGCTGCAGCAGG + Intergenic
933205038 2:79497427-79497449 ATGCAGAAGATGACAGCAGCAGG - Intronic
933207290 2:79521787-79521809 ATGCAGAAACAGGTGACAGAGGG + Intronic
933904001 2:86871450-86871472 ATTCAGAAGCTGGCTGCAGCTGG - Intergenic
934074344 2:88415095-88415117 ATGCAAAAACAGGCAGTGGATGG + Intergenic
934967398 2:98734463-98734485 CTGCTTCAACTGGCAGCAGAAGG + Intergenic
935058764 2:99590321-99590343 CTGCAGAAACAGGCAGGAGGTGG + Intronic
935398718 2:102637991-102638013 TTGCAGAAATTGGCATAAGATGG + Intronic
936003154 2:108854879-108854901 TTGCAGAAACTGCCATCAAAAGG - Intronic
936070944 2:109370792-109370814 ATGCACAAAGTGGAAACAGATGG - Intronic
936368234 2:111880684-111880706 ATTCAGAAGCTGGCTGCAGCTGG + Exonic
936806394 2:116337384-116337406 ATGCGGAATCGGGCAGCAGCAGG - Intergenic
937157906 2:119734242-119734264 CTGCAAGGACTGGCAGCAGACGG + Intergenic
937956614 2:127425268-127425290 TTCCAGAAGCTGACAGCAGATGG - Intronic
938926634 2:136049078-136049100 TTGAAGAAACTGACAGCTGAAGG + Intergenic
939741932 2:145918651-145918673 ATGCTGAAACTGCCAGCCCAAGG + Intergenic
939881722 2:147639267-147639289 ATGCAGAATAGGGCAGCAGAGGG - Intergenic
940856412 2:158731818-158731840 ATGCACCAGCTGCCAGCAGAGGG + Intergenic
941007435 2:160262387-160262409 AACCAGAAACTGCCAGCACAAGG - Intronic
941223283 2:162812334-162812356 ATGCAGAGACTGGCATCTGCAGG + Intronic
942074350 2:172342962-172342984 ATGCAGAAACAGTCATGAGAGGG - Intergenic
943237829 2:185346012-185346034 ATGGGGAAACTGGCATCAGGGGG - Intergenic
943419237 2:187648824-187648846 ATGCTGATACAGACAGCAGAAGG - Intergenic
944959913 2:204860439-204860461 ATGGAGAAACTGCTGGCAGATGG + Intronic
945042125 2:205751450-205751472 ATTCAGAAATTGTCAGGAGAAGG + Intronic
945617202 2:212086774-212086796 ATCCAGAAACTGTTAGGAGAAGG + Intronic
945682297 2:212928592-212928614 AGGCAGAAAAGGGAAGCAGATGG + Intergenic
945792672 2:214324955-214324977 CTGCATAAAATGGTAGCAGATGG - Intronic
946827343 2:223692400-223692422 ATGCTCAATCTGCCAGCAGAAGG + Intergenic
946944566 2:224807347-224807369 ATGTAGAAAGTGGTAGGAGAAGG + Intronic
948076848 2:235171736-235171758 AAACTGAAACTGGGAGCAGATGG - Intergenic
949017677 2:241722500-241722522 CAGCAGCAGCTGGCAGCAGAGGG - Intronic
1169072137 20:2739155-2739177 AGGCAGAAACAGGCACCAAAGGG - Intronic
1169112296 20:3041978-3042000 ACGCAGGGAGTGGCAGCAGAGGG - Intergenic
1169868083 20:10221539-10221561 ATGAACAAACAGGCATCAGAGGG - Intronic
1170044091 20:12066955-12066977 ATGCAGCATCTGGAAGTAGAGGG - Intergenic
1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG + Exonic
1172832362 20:37846666-37846688 ATGCAAAACCTTGCAGCAGCAGG - Intronic
1173048032 20:39531549-39531571 TTACAGAAGCTGGCAGCAGGTGG + Intergenic
1173623013 20:44450855-44450877 ATGCAGGGACTGGCAACAGTGGG - Intergenic
1173842963 20:46170733-46170755 ATGCAGGAGCTGGAAGCAAAGGG + Intergenic
1173913113 20:46684984-46685006 ATGGAGAAACTGGCCCCAAAAGG - Exonic
1175656413 20:60774987-60775009 TTGCAGAAATTGGAGGCAGAAGG + Intergenic
1175766324 20:61595196-61595218 ACCCAGACATTGGCAGCAGAGGG - Intronic
1176628849 21:9118936-9118958 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1178398984 21:32267091-32267113 ATGGTGACACTGGCAGGAGAGGG - Intergenic
1178709005 21:34897751-34897773 AAGCAGAAACTGGTTGTAGAAGG + Intronic
1179050491 21:37884919-37884941 AGGCAGAAAACTGCAGCAGAAGG - Intronic
1179148064 21:38786347-38786369 ATCCAGAAACAGACTGCAGAAGG - Intergenic
1180137629 21:45871517-45871539 AAGCAGAACCTGGCAGGGGAGGG - Intronic
1180419223 22:12798772-12798794 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1180728829 22:17966087-17966109 ATGATGAAGCTGGCAGCAGATGG - Intronic
1181590752 22:23883583-23883605 ATGCGGAAACTGGCTGAAGTTGG + Intronic
1182852144 22:33484466-33484488 ATGCAGAAACTCTAAGAAGATGG - Intronic
1182878010 22:33708942-33708964 ATGAAGACACTAGCAGAAGATGG - Intronic
1183632348 22:39041006-39041028 AGGCAGGAAGGGGCAGCAGAGGG - Intronic
1183641805 22:39097371-39097393 AGGCAGGAAGTGGCAGCAGAGGG - Intronic
1184012227 22:41757759-41757781 CTCCAGGAACTGGCAGCTGATGG - Intronic
1184189277 22:42884196-42884218 CTGCAGAAACACTCAGCAGAGGG + Intronic
949516578 3:4813094-4813116 ATGAACAATCTGGCAGCATATGG - Intronic
949642705 3:6057193-6057215 TGGCAGAAACTGGCACCAGGAGG + Intergenic
950234510 3:11307144-11307166 CTGCAGAAACTGGCATATGAAGG + Intronic
950808775 3:15631973-15631995 AAGGAGAAAGTGGCAGCAAAAGG - Intronic
951805095 3:26635199-26635221 CTCCAGAAACTGGCAGGAAATGG - Intronic
952871017 3:37901397-37901419 ATGGAGTGACTGGGAGCAGAGGG - Intronic
953093602 3:39753527-39753549 ATGCAGATGCTGGCAGCTGAAGG + Intergenic
953154619 3:40358161-40358183 ATGCATAAACTAGCTCCAGAAGG - Intergenic
955791053 3:62589272-62589294 ATGAAGATGCTGCCAGCAGAGGG + Intronic
956238828 3:67106419-67106441 ATGCAAATATTGGTAGCAGATGG - Intergenic
957401287 3:79717665-79717687 ATGCACAAAATAGCAGTAGATGG - Intronic
960015634 3:112885008-112885030 ATGCACATGCTGGCAGCAGCAGG + Intergenic
960630065 3:119721302-119721324 CTGAATAAACTGGGAGCAGAAGG + Intronic
961549888 3:127663372-127663394 ATCTAGACACTGGAAGCAGATGG - Intronic
961633941 3:128321351-128321373 AGGCAGAACTTGGCAGCAGCTGG - Intronic
962417168 3:135193572-135193594 AAGCAGAAGCTGAGAGCAGAGGG + Intronic
964790188 3:160446755-160446777 ATGCTGACACTGGCAGGAGGCGG - Intronic
965783625 3:172314066-172314088 CTGTAGAAACTACCAGCAGAAGG - Intronic
965879551 3:173372033-173372055 ATGCAGAAGAGGTCAGCAGATGG + Intergenic
968350121 3:198046658-198046680 AAGCAGGACCTGGGAGCAGAGGG + Intergenic
968948483 4:3678034-3678056 CTGCAGAAAATAGCAGCTGAGGG + Intergenic
969030283 4:4206629-4206651 ATGCAGTCACTAGCAGCATACGG + Intronic
969101157 4:4769214-4769236 AGGCAGAATGTGGCAGGAGACGG - Intergenic
969486779 4:7476775-7476797 GTGGAGAAAATGGAAGCAGAGGG - Intronic
969632673 4:8347468-8347490 ATGGAGAAACAGGCAGCAGCTGG - Intergenic
970126440 4:12817579-12817601 AGACAGAAACTGGCAGTAAATGG + Intergenic
970484385 4:16509674-16509696 ATTCAGTAACTGGCAGGAGAAGG - Intronic
971703720 4:30012903-30012925 ATGCAGAAGCTGGCTGTAGTAGG + Intergenic
972157487 4:36182200-36182222 ATGCAGAAACTGGCCGGGCATGG + Intronic
974381988 4:61152942-61152964 ATGGAGAAACTGGAAACTGAGGG + Intergenic
977068162 4:92345703-92345725 ATCCAGAAACTGGCAATAGCAGG - Intronic
977656887 4:99533040-99533062 ATGGAGAAAGTGGCAAGAGATGG + Intronic
980525879 4:133990843-133990865 ATCCAGAAACTGAGAGCAAAGGG - Intergenic
981550790 4:145938476-145938498 AGGCAGACACTGGCAGGAGCGGG + Intronic
982131438 4:152232421-152232443 CTGCATAGATTGGCAGCAGAAGG - Intergenic
982245705 4:153348174-153348196 ATGCTGAAACTGGCAGAACTTGG + Intronic
984884785 4:184440566-184440588 CTGGAGAACCTCGCAGCAGATGG + Intronic
985018745 4:185664606-185664628 ATTCAGAGACTGGCTACAGAAGG - Intronic
985934150 5:3081642-3081664 ATGCAGAACATGGCAGCTGCTGG - Intergenic
986375004 5:7122105-7122127 ATCCAGAAACTGGAAGAAGTGGG - Intergenic
987324235 5:16797765-16797787 AAGCAGACAGTGGCAGGAGAGGG + Intronic
987736283 5:21847587-21847609 ATGCAGAAGAAGGAAGCAGAAGG - Intronic
988689244 5:33555926-33555948 ATGGAGAAACTGGCCTGAGAAGG - Intronic
989783395 5:45297570-45297592 TTCCAGAAAATGGAAGCAGAAGG + Intronic
991482831 5:67101430-67101452 CTGCAGGGACTGGCAGCTGAAGG + Intronic
991666096 5:69001389-69001411 ATGCAGTAGCTGGCAGATGAAGG + Intergenic
991734414 5:69618665-69618687 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
991810848 5:70473800-70473822 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991859852 5:71003483-71003505 CTGCAGATAGGGGCAGCAGAGGG + Intronic
991873012 5:71128379-71128401 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
992208059 5:74450318-74450340 AGGCAGGAACAGGCACCAGAGGG - Intergenic
992373220 5:76166674-76166696 ATTCAGAAACTGGAAGGGGAGGG - Intronic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994145623 5:96391871-96391893 AAGCAGAAACTGGCAGGCCATGG - Exonic
995379501 5:111516583-111516605 ATTGAGAAACTGGCAACACAAGG + Intergenic
995890779 5:116948099-116948121 ATGCCGTATCTGCCAGCAGAGGG - Intergenic
996150679 5:120030627-120030649 ATACAGAAAATGACAGCAAATGG - Intergenic
996259470 5:121447603-121447625 ATCCAGAAAATGGCATCAAAAGG + Intergenic
996542876 5:124648273-124648295 ATGCCTAAACTGGAAGCAGAAGG - Exonic
997859071 5:137400134-137400156 ATGCACACACTGACTGCAGAGGG - Intronic
1001661282 5:173395432-173395454 CTCTAGAAACTGCCAGCAGAGGG + Intergenic
1004893210 6:20121707-20121729 ATACAGAAAATGGGAGCAGGAGG + Intronic
1005629733 6:27696188-27696210 ATGCAGGAAATGGCAGAAAACGG - Intergenic
1006190411 6:32204147-32204169 AGGCAGACACTGGCAGTAGAAGG + Exonic
1006345980 6:33483127-33483149 AGGCAGAAAGTGGCAATAGAAGG - Intergenic
1007075468 6:39063469-39063491 ATGGTGAAACTGACAGCAGTGGG - Intronic
1009850609 6:69193231-69193253 AGGCAGGAGCTGGCAGAAGATGG - Intronic
1011018420 6:82783969-82783991 ATGCAGAAACAGGCAGCCTGTGG + Intergenic
1013068860 6:106710058-106710080 AGAGAGAAAGTGGCAGCAGAAGG - Intergenic
1013597188 6:111670788-111670810 GGGGAGAAACTGGAAGCAGAGGG + Intronic
1013744842 6:113333573-113333595 ATGGGGAAACTGGAAGGAGAAGG + Intergenic
1015626322 6:135183032-135183054 GAGCTGAAACTGGCAGCAGGAGG + Intronic
1016586897 6:145698349-145698371 ATGCAGAAAAAGGAAACAGAAGG + Intronic
1016739576 6:147513129-147513151 CTGGAGAAAGTGGCAGGAGATGG + Intronic
1016981407 6:149857975-149857997 ATGCAGAAACTAGGCTCAGAGGG + Intronic
1017022019 6:150147757-150147779 AAGCAGACACTGGAAGCAAAGGG - Intronic
1017024842 6:150172709-150172731 TTGCTGAAACTGGAAGCAGGGGG + Intronic
1017691554 6:156970954-156970976 CTGCAGAAGCTGGCAGCAGAGGG - Intronic
1018062740 6:160103363-160103385 ATGCAGAATGGGGCAGAAGAAGG + Intronic
1018279570 6:162171226-162171248 ATGGAGAAACTGGAAGGAGGAGG + Intronic
1018667113 6:166148915-166148937 CTGCAGTAACTGGGAGGAGAGGG - Intergenic
1019046863 6:169156146-169156168 ATTCAGAAGCTGGGAACAGAGGG + Intergenic
1019338719 7:497452-497474 GTCCAAACACTGGCAGCAGAGGG + Intronic
1019471056 7:1221223-1221245 ATGCAGACACTGCCAGCAGAAGG + Intergenic
1020764209 7:12300669-12300691 AGGCAGAAACTAGCAGTAAATGG + Intergenic
1020882001 7:13774150-13774172 AGGCAGAAACAGGCAGTAAATGG - Intergenic
1020894233 7:13919207-13919229 ATGAAGAAACTGGAGGCATAAGG + Intronic
1021243319 7:18231710-18231732 ATGCAGAAAATTGATGCAGAAGG + Intronic
1022272112 7:28818641-28818663 ATGCAGAAACTGGGGTCTGAAGG - Intronic
1023178875 7:37460935-37460957 ATACAGAAACTGGCTGGACATGG - Intergenic
1024645398 7:51366760-51366782 AGCCTGAAGCTGGCAGCAGACGG + Intergenic
1027640988 7:80733689-80733711 ATGCAGAAACTGTCAGAACAAGG - Intergenic
1027809640 7:82878897-82878919 TTACAGAAGCAGGCAGCAGATGG + Intronic
1028292703 7:89086681-89086703 ATGCTGAACCATGCAGCAGATGG + Intronic
1029017372 7:97328203-97328225 AAACAGAAACTGGCAGTAAATGG - Intergenic
1029346085 7:99979926-99979948 ATACAGAAGCTGCCAGCAGGGGG + Intergenic
1030070238 7:105692082-105692104 ATGTAGATATTGGCAGCTGAAGG + Intronic
1030864610 7:114684326-114684348 ATTCAGAAACTGTCAGAGGAGGG + Intronic
1031671339 7:124550246-124550268 ATGCAGCATCTGGCAGCTTAGGG - Intergenic
1032197509 7:129797858-129797880 ATGCAGGAACCTGCAGCCGACGG - Intergenic
1032498366 7:132380090-132380112 ATGCTGAAACTGGCCCCATATGG + Intronic
1032832304 7:135640563-135640585 AAGCAGACACTGGTAGGAGAAGG - Intronic
1033461696 7:141552085-141552107 AAGTAGAAATTGGCAGCAGTTGG - Intronic
1033618764 7:143042722-143042744 AAGCAGAAATTGTGAGCAGAAGG - Intergenic
1034300487 7:150010904-150010926 ATAAAGAAAGTGGCAGCAGCAGG - Intergenic
1034805567 7:154086404-154086426 ATAAAGAAAGTGGCAGCAGCAGG + Intronic
1035128295 7:156627252-156627274 AGGCAGAAACTGGCAGTACATGG + Intergenic
1035846283 8:2868450-2868472 ATACAGAAACTGGTACAAGAGGG - Intergenic
1036793879 8:11741870-11741892 CGGCAAAAGCTGGCAGCAGATGG - Intronic
1038730669 8:30124177-30124199 ATGAAGAAAATGCCAGAAGAGGG + Intronic
1040297082 8:46157654-46157676 TTGCAGATACTGTCAGAAGAGGG + Intergenic
1040385000 8:46909102-46909124 ATGAAGAAACTTGCCTCAGAAGG + Intergenic
1040449960 8:47535235-47535257 ATCCAGAAAATAGAAGCAGAAGG + Intronic
1041286612 8:56268974-56268996 ATGCACAAACTAGTAACAGAGGG - Intergenic
1041629866 8:60075152-60075174 CTGCTGAAAGTGGAAGCAGAAGG + Intergenic
1041721593 8:60980998-60981020 ATGCAGAAACCACCAGCAGCTGG + Intergenic
1042008329 8:64208818-64208840 GTCCAGAAACTGAGAGCAGAGGG + Intergenic
1043304862 8:78782204-78782226 ATGGATAAACTGGCAGAAGTAGG - Intronic
1043560981 8:81492818-81492840 ATCAAGAATCTTGCAGCAGAAGG - Intergenic
1044032562 8:87256518-87256540 ATGAAGTGCCTGGCAGCAGAAGG + Intronic
1044057304 8:87587075-87587097 AAGAAAAAACTGCCAGCAGATGG - Intronic
1044681292 8:94780603-94780625 CTGCAGAAAATGGCATCAGGTGG - Intronic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1045561191 8:103265166-103265188 TTTCAGAAACTTCCAGCAGATGG - Intergenic
1045935263 8:107671424-107671446 ATGAAGAAATTGGCAGAAGCAGG + Intergenic
1045952472 8:107866774-107866796 ATGCAGATCCTGGGAACAGACGG - Intergenic
1046529825 8:115429278-115429300 AAGCAAAAACTGGCAGCATAAGG - Intronic
1046779031 8:118195597-118195619 AAGAAGAACATGGCAGCAGACGG - Intronic
1048114467 8:131506200-131506222 ATGAAGAAGATGGCAGCAAATGG + Intergenic
1048200077 8:132365441-132365463 GTGAAGCAACTGGAAGCAGATGG - Intronic
1049348858 8:142153402-142153424 ATGAAGCCGCTGGCAGCAGAAGG + Intergenic
1049625161 8:143616624-143616646 ATCCAGAAGGTGGTAGCAGATGG - Exonic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1051560028 9:18430353-18430375 ATGCTGAACTTGGCATCAGAAGG - Intergenic
1053279072 9:36805768-36805790 GAGCAGACACTGGCAGCAGAAGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1056905652 9:90645491-90645513 ATGCAGACACCAGCAGCAAATGG + Intergenic
1058222749 9:102323460-102323482 TTCCAGAAAATGGAAGCAGAGGG + Intergenic
1058806947 9:108602083-108602105 AAACTGAAACTGGCTGCAGATGG - Intergenic
1058961967 9:109999852-109999874 AAGGAGGAGCTGGCAGCAGAAGG + Intronic
1060115957 9:120940912-120940934 ATGCAGACACTGGGAGAGGACGG - Intergenic
1060308926 9:122441769-122441791 AAGGAGAAACTAGCAGCAGGGGG + Intergenic
1061600855 9:131669121-131669143 AGGCAGGAGGTGGCAGCAGACGG + Intronic
1203751697 Un_GL000218v1:86617-86639 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1186451859 X:9680550-9680572 ATGGAGAAAATGTCAGCAGCAGG - Intronic
1186666796 X:11725098-11725120 TTGCAAAAACAGGCAGCAGGTGG + Intergenic
1186786535 X:12961384-12961406 ATGCTAAAACTGCCAGCAGAGGG - Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1187598643 X:20802245-20802267 ATGCAGACACTGGCAGCTGGAGG - Intergenic
1189171822 X:38916669-38916691 TGGGAGCAACTGGCAGCAGACGG - Intergenic
1189346902 X:40248590-40248612 AATCAGAAGCTGGCATCAGAGGG + Intergenic
1189592014 X:42523546-42523568 ATTCAGAAACAGACAGCTGAGGG - Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1191594502 X:62927729-62927751 ATGAAGAAAGTAGAAGCAGAGGG - Intergenic
1192207483 X:69106004-69106026 ATGGAAAATCGGGCAGCAGAGGG + Intergenic
1192567075 X:72173899-72173921 AAGGTGAAACTGGCAGCAGAGGG + Intergenic
1196832348 X:119785813-119785835 GTACAAAAACAGGCAGCAGATGG + Intergenic
1199242587 X:145564989-145565011 ATCCAGAGACTAGCAGCAGAAGG - Intergenic
1199392419 X:147296562-147296584 ATTGAGAAACTGGGAGGAGATGG - Intergenic
1201165354 Y:11204237-11204259 ATGGAGACACTGGCTGCAGTGGG + Intergenic