ID: 1134045271

View in Genome Browser
Species Human (GRCh38)
Location 16:11096391-11096413
Sequence CTGTGGTTATCCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134045271 Original CRISPR CTGTGGTTATCCAGGGAAGT GGG (reversed) Intronic
903019870 1:20386476-20386498 CTGGGGGTATCCAGGGCTGTGGG - Intergenic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
908094331 1:60721372-60721394 CTGAGGTTGTGCAGGGCAGTGGG - Intergenic
911329696 1:96512641-96512663 CTTTAGGTATCCAGAGAAGTAGG + Intergenic
913674697 1:121129960-121129982 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914026538 1:143917590-143917612 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914664918 1:149825021-149825043 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914670847 1:149868799-149868821 CTGGGGTCATCCAGGGCAGGAGG + Intronic
914841038 1:151249005-151249027 CTGTCTTCATGCAGGGAAGTTGG + Intronic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
914932383 1:151946880-151946902 CTGTGGTGGTCAAGGGAGGTGGG + Intergenic
915661223 1:157407206-157407228 CTGTGGCAATCCATGGCAGTTGG + Intergenic
916813943 1:168332545-168332567 CTGTGCTTTTCTAGGGAAATGGG + Intergenic
917096538 1:171404203-171404225 CTGTGGATACCCAGTGAAGGTGG - Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
919929341 1:202211069-202211091 CTGTGAAGATCCAGGGAACTGGG + Intronic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
922625178 1:227033358-227033380 CTGATGTTATCCATGCAAGTCGG - Exonic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924836434 1:247652497-247652519 TTGTGGTTCTCCAGAGAAGATGG - Intergenic
1063515277 10:6688932-6688954 CTGTGGGAATCCAGGGCAGCGGG + Intergenic
1068420833 10:56790142-56790164 CTTTGTTTATCCAAGGAAATGGG - Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1070439689 10:76431387-76431409 CTGTCGTCACCCAGGGAAGCAGG - Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1075988331 10:126808600-126808622 CAGTGGTTATCTATGGAGGTAGG + Intergenic
1076674869 10:132142551-132142573 CTAAGGTGAGCCAGGGAAGTGGG - Intronic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079275971 11:19038062-19038084 CTGGAGTAATCCAGGGAAGAAGG - Intergenic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084172063 11:67405572-67405594 CTGTGGGTAGCCAGGAAGGTGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087405203 11:97721848-97721870 GTATAGTTCTCCAGGGAAGTGGG - Intergenic
1089428441 11:118400741-118400763 TTGTGGTTAACTAGGGAATTAGG + Intronic
1090243045 11:125197456-125197478 CTGTGGGTCCCCAGGCAAGTGGG - Intronic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1098202650 12:68072704-68072726 CAGTTATTATCCAGGGAAATGGG - Intergenic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1107562294 13:41568360-41568382 CTGTGGTTTGCCAGGGCAGGAGG - Intronic
1108001704 13:45910445-45910467 CTGAGGGCATCCAAGGAAGTGGG - Intergenic
1110886474 13:80643649-80643671 ATGAGGTTATCCTGGAAAGTGGG - Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1119524924 14:75315247-75315269 CTGTGGCTATTCTGGGAATTTGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121314364 14:92952308-92952330 CTGTCACTATACAGGGAAGTAGG + Intronic
1121384802 14:93510168-93510190 CTGAGGTTGTGCAGGGCAGTGGG + Intronic
1121725845 14:96149161-96149183 ATGTAGTTTGCCAGGGAAGTGGG + Intergenic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1125500395 15:40236733-40236755 ATGTGGTTATCCTTGGAAATAGG - Intergenic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1127682015 15:61306634-61306656 CTGAGCTGAACCAGGGAAGTGGG + Intergenic
1127992536 15:64131407-64131429 CTTTGGTTCTCCAGGGATATTGG + Intronic
1133301286 16:4784216-4784238 CTCTGATGATGCAGGGAAGTGGG - Intronic
1133964810 16:10523000-10523022 CTGTGGGTAGACAGGGAACTGGG + Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134409619 16:13993141-13993163 CTGTGATCATCCAGGGAGGGAGG + Intergenic
1134680504 16:16121809-16121831 CTGTGGTTCACCAGGTGAGTGGG + Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135165139 16:20132446-20132468 CAGTGGTTATCATGAGAAGTGGG + Intergenic
1136650906 16:31669540-31669562 CTCTGGTTCTCAAGGGGAGTTGG + Intergenic
1138256319 16:55565989-55566011 CAGTGGTTATCCTTGGAAGACGG + Intronic
1138882559 16:61033207-61033229 CTGGGGTAATCCAGGGCAGGAGG - Intergenic
1138916042 16:61466180-61466202 ATCTGGTTATCCAGGTAAGGTGG - Intergenic
1138916402 16:61470509-61470531 ATGCGGTTATCCAGGAAACTGGG + Intergenic
1139311603 16:66032604-66032626 CTGTGGCTATCCTTGGCAGTGGG - Intergenic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1145398347 17:22512836-22512858 CTGTGGTCAGGCAGGCAAGTGGG + Intergenic
1155653078 18:28163952-28163974 CTGGGGATGTCCAAGGAAGTAGG + Intronic
1156872005 18:41955865-41955887 CAGTGTTTAGTCAGGGAAGTTGG + Intronic
1159578482 18:70207603-70207625 CTGTAGTTATCCAGGAAGGAAGG + Intergenic
1159821103 18:73144946-73144968 CTTTGGTTATTCAGGGACTTTGG + Intergenic
1160536859 18:79599114-79599136 CTGTGGTCATCCCGGGAGGTGGG - Intergenic
1161081932 19:2315586-2315608 CTGTTGTTTTCCAGAGAAGGGGG + Intronic
1161505272 19:4640274-4640296 CAATGTTTGTCCAGGGAAGTGGG + Intronic
1165527267 19:36366674-36366696 CAGTGGTTACCCTGGGCAGTAGG + Intronic
1165544713 19:36525350-36525372 CTGTGGATATACAAGGAAGCAGG + Exonic
1167669825 19:50844311-50844333 ATGTGGGTCACCAGGGAAGTGGG + Intergenic
1168526893 19:57095761-57095783 CTGAGGTTTTCCAGGGTGGTAGG + Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG + Intergenic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
929395609 2:41518766-41518788 ATGTGGTTCTCCTGGGAAGGAGG + Intergenic
930079855 2:47436791-47436813 CTGTGCCTATACAGGGAGGTTGG - Intronic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
935253868 2:101290854-101290876 CAGGGGTTAGCCAGAGAAGTAGG - Intronic
936057914 2:109275265-109275287 CTCTTGTGATCCAGAGAAGTAGG + Intronic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
938341150 2:130537526-130537548 CAGTTGCTATCCAGGGAAATGGG - Intergenic
938348680 2:130583183-130583205 CAGTTGCTATCCAGGGAAATGGG + Intronic
940627049 2:156188019-156188041 TTGTAGTCATCCAGGGAACTGGG - Intergenic
948713962 2:239847017-239847039 ATGTGGGTTTTCAGGGAAGTGGG - Intergenic
1169182012 20:3577594-3577616 CTGAGCTTGTTCAGGGAAGTTGG + Intronic
1169997912 20:11579426-11579448 CTGTGGTAATTCTAGGAAGTTGG - Intergenic
1170232286 20:14063330-14063352 CTGTGGTCATTCAGGGACATAGG + Intronic
1170288856 20:14745095-14745117 CTTTGGTTTTTCAGGGAGGTGGG + Intronic
1170709746 20:18779514-18779536 CTCTGGATATCCAGGAATGTAGG + Intergenic
1172795659 20:37535421-37535443 CAGTGGTGATACAGGAAAGTAGG + Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1175626959 20:60496845-60496867 ATTTGGTTATCTTGGGAAGTGGG - Intergenic
1175804931 20:61821881-61821903 CTGTGGTTCTCCAGCCAGGTGGG + Intronic
1178327261 21:31656029-31656051 CAATGGTTATCGATGGAAGTAGG - Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179011760 21:37561883-37561905 CTGATGTGATCCAGGGAAGGCGG - Intergenic
1179449485 21:41458742-41458764 GTGTGGTTAACCGGGGAACTGGG - Exonic
1180102465 21:45595232-45595254 CTGTGGTCACCCAGGGAGGGAGG + Intergenic
1181304034 22:21904243-21904265 CTTTGGTTACACAGCGAAGTCGG + Intergenic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184509644 22:44926059-44926081 CAGTGGATTTCCGGGGAAGTGGG + Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
950502997 3:13376282-13376304 CTGTGGTGGACCAGGCAAGTTGG - Exonic
952086083 3:29823241-29823263 TAGTGGTTATCCATGGTAGTTGG - Intronic
954435556 3:50493997-50494019 CAGGGGCTAGCCAGGGAAGTGGG + Intronic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
956939330 3:74138650-74138672 CTGTGCTTATCCTGTGGAGTTGG + Intergenic
958819130 3:98952481-98952503 ATATAGTTTTCCAGGGAAGTTGG + Intergenic
958832324 3:99104693-99104715 ATGCTCTTATCCAGGGAAGTGGG - Intergenic
959274378 3:104259202-104259224 CTGTGTGTATCCTGGGAATTGGG + Intergenic
959933915 3:112010723-112010745 CTGTGGTTAACATGGGAGGTGGG + Intronic
960995152 3:123335791-123335813 CTGTGCTTCTCCTGGGAGGTGGG - Intronic
961781593 3:129323827-129323849 CTGTGGTGGACCAGGCAAGTTGG - Intergenic
965194045 3:165571921-165571943 CAGTGGTTTTCCAGGGACTTGGG + Intergenic
966673937 3:182564508-182564530 CTGTGTTTATCCAGGCCAGGTGG - Intergenic
974714455 4:65649319-65649341 CTTTGGATGTCCAGGGAAATAGG - Intronic
976141949 4:82002201-82002223 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
980153742 4:129080043-129080065 CTGAGGTTGTACAGGGCAGTGGG + Intronic
980771176 4:137375238-137375260 GTTTGGTTAGCCAGGGAAGAAGG + Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
988820010 5:34873712-34873734 TTGTGGGTATCCAGGGATGTGGG - Intronic
992122616 5:73610257-73610279 CTGTGGTTATCAGGGGGAGCTGG - Intergenic
992870127 5:80997512-80997534 GTGTATTTATCCAGGCAAGTTGG + Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
999775780 5:154812087-154812109 CTGGGTATATCAAGGGAAGTTGG + Intronic
999914441 5:156242210-156242232 AGGTGGATATCCAGGGAATTTGG + Intronic
1002454608 5:179338966-179338988 ATGGGGTCATCCAGGGAAGGGGG + Intronic
1006045051 6:31288057-31288079 CTGGGGTAAGGCAGGGAAGTGGG + Intronic
1008132958 6:47739410-47739432 TTGTGGTTTGCCAAGGAAGTGGG + Intergenic
1008133042 6:47740040-47740062 TTGTGGTTTGCCAAGGAAGTGGG + Intergenic
1009024903 6:57987090-57987112 CTGTCGTTATCTATGGTAGTTGG - Intergenic
1009200477 6:60738548-60738570 CTGTGGTTATCTATGGTAATTGG - Intergenic
1011225183 6:85097228-85097250 CTGTAGGTTGCCAGGGAAGTGGG - Intergenic
1011239089 6:85251666-85251688 CTCTGGTTATTAAGGGAATTTGG + Intergenic
1013189393 6:107789402-107789424 CTGTGTTTATGCGGGGCAGTGGG - Intronic
1015732166 6:136360462-136360484 CTGGGGTTATTCAAGAAAGTTGG + Intronic
1019611735 7:1940181-1940203 CTGTGCTTCTCCTGGGAAGGAGG + Intronic
1019616621 7:1965859-1965881 TTGTGGTCCTCCAGGGACGTGGG - Intronic
1021847085 7:24773874-24773896 ATGTGGTTATGCTGGGAACTAGG - Intergenic
1021966177 7:25921442-25921464 TGGTGGTTGTCCAGGGCAGTCGG + Intergenic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1026534359 7:71227967-71227989 CTATGCATATCCAGGGAAGAAGG - Intronic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1028197109 7:87920149-87920171 ATATGGTTCACCAGGGAAGTAGG - Intergenic
1028207203 7:88031788-88031810 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
1028658230 7:93235481-93235503 CTGTGGTAATCCAGGTGAGAGGG + Intronic
1030768160 7:113438022-113438044 CTGTGATCATCCAGGGATATTGG + Intergenic
1033291909 7:140092407-140092429 CTGTGACTTGCCAGGGAAGTGGG - Intronic
1037161664 8:15780684-15780706 CTGGGGTGAGCCAGGGAAGAGGG - Intergenic
1038131721 8:24739615-24739637 CTGTGCTTATCAAGAGAACTAGG + Intergenic
1038331506 8:26613160-26613182 CTGTGTTCATCCAGGAAAATGGG + Intronic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041855422 8:62447753-62447775 CTTTGGATATCCAAGGAAGGGGG - Intronic
1044351036 8:91166965-91166987 CTGTGACTATCCAGCAAAGTGGG - Intronic
1047524507 8:125621096-125621118 ATGTAGTTATACAGAGAAGTTGG + Intergenic
1047787557 8:128168491-128168513 CTGTGGTTCTCCAGGGCTGGAGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1055053011 9:71998578-71998600 CAGTGCTTATCCAGGGAAGGAGG + Intergenic
1055165291 9:73184775-73184797 CAATGGTTCTCCAGGGATGTGGG - Intergenic
1055921227 9:81463175-81463197 TTGTTGTTACCCATGGAAGTTGG - Intergenic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1060424512 9:123493293-123493315 CTGTGGGCAACCAGGGAGGTTGG + Intronic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1060972317 9:127745219-127745241 CTCTGGTGATGCAGGGAGGTGGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1187717238 X:22114801-22114823 GTGTAGTTTTCCAGGGGAGTGGG + Intronic
1189074755 X:37904452-37904474 CTGGTATTATTCAGGGAAGTAGG + Intronic
1192242941 X:69349186-69349208 TAGTGGTTATCCAGAGAAGGTGG - Intergenic
1192584390 X:72307831-72307853 CTGTGGTCATCCAGGGCAGGAGG + Intergenic
1193269262 X:79510265-79510287 CTGTGGTTTTACAGAGAGGTGGG - Intergenic
1196181625 X:112698305-112698327 CTGTGGTAATCCAGTGTAGATGG + Intergenic
1196462117 X:115942424-115942446 CTGTGTTTATCCAGGTAGCTGGG - Intergenic
1199134445 X:144234210-144234232 CTGAGGCTGCCCAGGGAAGTGGG - Intergenic
1200308264 X:155051121-155051143 CTGTTTTTATCAAGGGAAATAGG + Intronic