ID: 1134045547

View in Genome Browser
Species Human (GRCh38)
Location 16:11098486-11098508
Sequence GCTCTTAGGAAGCCACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134045547_1134045555 21 Left 1134045547 16:11098486-11098508 CCCAGCTGTGGCTTCCTAAGAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1134045555 16:11098530-11098552 GGCCATCCATAATGGTATTTGGG 0: 1
1: 1
2: 0
3: 5
4: 63
1134045547_1134045553 13 Left 1134045547 16:11098486-11098508 CCCAGCTGTGGCTTCCTAAGAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1134045553 16:11098522-11098544 GTTAGTGTGGCCATCCATAATGG 0: 1
1: 0
2: 0
3: 6
4: 365
1134045547_1134045552 0 Left 1134045547 16:11098486-11098508 CCCAGCTGTGGCTTCCTAAGAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1134045552 16:11098509-11098531 TGAGCGTGAGGGCGTTAGTGTGG 0: 1
1: 0
2: 1
3: 3
4: 93
1134045547_1134045554 20 Left 1134045547 16:11098486-11098508 CCCAGCTGTGGCTTCCTAAGAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1134045554 16:11098529-11098551 TGGCCATCCATAATGGTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134045547 Original CRISPR GCTCTTAGGAAGCCACAGCT GGG (reversed) Intronic
900713691 1:4130568-4130590 TCTCTAAGGAAGCCACAGGAAGG + Intergenic
901292738 1:8136971-8136993 GCTCTCAGGAAGCCAGATCAAGG + Intergenic
904249351 1:29211908-29211930 GTTCTTAGTTGGCCACAGCTTGG - Intronic
905883302 1:41478314-41478336 GCTGTGATGGAGCCACAGCTTGG - Intergenic
906618071 1:47248796-47248818 TTTCTCAGAAAGCCACAGCTGGG + Intergenic
907350030 1:53821330-53821352 GCTCTTTGGAAGGCTGAGCTGGG + Intronic
907499037 1:54865086-54865108 GCTCTTAGCAAGCATCTGCTTGG - Intronic
908428365 1:64031190-64031212 GCTGTTTGGAGGACACAGCTTGG + Intronic
910939382 1:92516722-92516744 GCTAGAAGAAAGCCACAGCTGGG + Intronic
911686092 1:100779399-100779421 TCTCTTAGTAATCCACATCTAGG + Intergenic
915076316 1:153310797-153310819 GCCCTCAGGAAGCCACAGGATGG - Intergenic
915364039 1:155303952-155303974 GCTCTGAGGAAGAAAAAGCTTGG + Intergenic
916667439 1:166978909-166978931 ATTCCCAGGAAGCCACAGCTGGG + Intronic
917802254 1:178581433-178581455 GCTCCTAGGAAGCTAAAGTTAGG - Intergenic
918272129 1:182912193-182912215 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
918791753 1:188839014-188839036 GATCTTAGGCAGCGACATCTTGG - Intergenic
920074653 1:203327436-203327458 GCTCTGGGGAAGCCCCACCTTGG + Intergenic
920557984 1:206918220-206918242 GCACTAAGGAAGCCACACCAAGG - Intronic
921532816 1:216306753-216306775 GCTCTCAGGAAGGCACATCCTGG - Intronic
922947353 1:229528409-229528431 GCTCTTAGGGAGGCAGAGGTGGG - Intronic
923459353 1:234195196-234195218 GCTCCTAGGTAGGCACAGCCTGG - Intronic
1065117944 10:22500097-22500119 GCTCTTTGGGAGGCCCAGCTGGG + Intergenic
1068680273 10:59811696-59811718 GCCCTGAGGAACCCACAGATAGG + Intronic
1072716133 10:97753760-97753782 GATCCTAGGAACCCACAGCGTGG - Intronic
1073277315 10:102323650-102323672 GCTCTTAGGGAGGCAGAGATGGG - Intronic
1074217528 10:111400803-111400825 GCTCTTTGAAAGACACTGCTAGG - Intergenic
1075343566 10:121666014-121666036 CCTCTTAGGAAACCACAGGACGG + Intergenic
1075763032 10:124871135-124871157 GCTCTGAGAAAGTCTCAGCTAGG + Intergenic
1076842969 10:133055674-133055696 GCCCTCAGGAAGCCACATCGTGG - Intergenic
1077712614 11:4551900-4551922 GATCTGAGGAATCCAAAGCTAGG + Intergenic
1078551247 11:12281786-12281808 CCTCTTAGTAAGCCAGAGCTTGG - Intronic
1078612901 11:12837413-12837435 TCTCTTTGGAAGCTACAGATAGG + Intronic
1079061226 11:17250728-17250750 TCTCATAGAAAGCCACAGCTTGG + Intronic
1084834221 11:71791217-71791239 GCTCTGAGGTGGCCACAGCCTGG - Intronic
1086033248 11:82384964-82384986 GCTCTTGGGCCACCACAGCTAGG - Intergenic
1088146478 11:106686530-106686552 GCTCTTAGGAGGCATCAACTGGG + Intronic
1088887915 11:114021986-114022008 GGTCTTACTAAGCCACAGGTAGG + Intergenic
1090220025 11:125012087-125012109 GCTCTGAGGAAGACAAAGGTGGG + Intronic
1091679619 12:2517549-2517571 CCACTTAGGAAGCCACATCCAGG - Intronic
1095827880 12:46549236-46549258 GCACTTAGGGAGCCCAAGCTGGG + Intergenic
1095964650 12:47858653-47858675 GCACTCAGCAAGCCACAGCCAGG - Intronic
1098488031 12:71044517-71044539 GGTGTTATGAAGGCACAGCTAGG + Intergenic
1099177156 12:79435413-79435435 GCTCTTAGGGAGGCAGAGGTGGG - Intronic
1101712991 12:107286091-107286113 TCTCTTAGGGAGCCACTTCTTGG - Intergenic
1104814758 12:131639354-131639376 GCTCTGGGGACTCCACAGCTAGG + Intergenic
1104846219 12:131848440-131848462 GCCATTTTGAAGCCACAGCTCGG + Intronic
1107235165 13:38159847-38159869 TCTCTTGGGAAACCACAGGTAGG - Intergenic
1108266460 13:48713770-48713792 GCACTTTGGAAGCCCGAGCTGGG - Intergenic
1108810196 13:54213743-54213765 GTTCTTAGGAAGACAGAGATGGG + Intergenic
1113280054 13:108779134-108779156 GATCTTAGGAAACCCCCGCTTGG - Intronic
1113714205 13:112491730-112491752 GCTCTTAGGGAGGCAGAGGTGGG - Intronic
1114046251 14:18879043-18879065 GCTCTTAGGGAGGCAGAGGTGGG - Intergenic
1114117959 14:19640407-19640429 GCTCTTAGGGAGGCAGAGGTGGG + Intergenic
1116889197 14:50250510-50250532 GCTGTCTGGAAGCCACAGATTGG - Intronic
1118226330 14:63902922-63902944 GCACTTAGGAAGCCAGAGGCAGG - Intronic
1118374721 14:65166921-65166943 GCTCCAAGAAAGCCACAGCCAGG + Intergenic
1118741244 14:68740980-68741002 AATCTTAGAAAGCCAGAGCTGGG + Intergenic
1119161551 14:72456829-72456851 GCTCTTTGGGAGGCTCAGCTGGG + Intronic
1119242818 14:73075890-73075912 GCTCTTAGGGAGGCACAGGCAGG - Intronic
1119381120 14:74229001-74229023 ACTCTAAGGAAGCAGCAGCTAGG - Intergenic
1124632625 15:31346193-31346215 GCTTTCTGGAAGCCACAGATGGG - Intronic
1125433729 15:39624720-39624742 GCTCTTAAGAAGCCAAACCAAGG + Intronic
1126095527 15:45087081-45087103 GCTATTAGGAAACCAGACCTTGG + Intergenic
1128111308 15:65077816-65077838 GCTCTGCGGACGCCGCAGCTCGG - Exonic
1131433514 15:92405012-92405034 GCTCTTAGGGAGGCACAGGCAGG + Intronic
1131616712 15:94023924-94023946 GACCTTAGGTAGCCTCAGCTGGG + Intergenic
1132247737 15:100310449-100310471 TTTCTTAGGAAGCCAGTGCTTGG - Intronic
1133098309 16:3463205-3463227 GCTTTTAGTTAGCAACAGCTTGG - Intronic
1133349835 16:5094064-5094086 GCTCTGAGGTGGCCACAGCCTGG + Intronic
1134019265 16:10910196-10910218 GTTCCTCGGAAGACACAGCTGGG + Exonic
1134045547 16:11098486-11098508 GCTCTTAGGAAGCCACAGCTGGG - Intronic
1137540072 16:49356005-49356027 GGTCTTGGGAAGCCCGAGCTGGG - Intergenic
1138121225 16:54402343-54402365 GCACTTAATAACCCACAGCTTGG + Intergenic
1138227164 16:55305891-55305913 GGTCTTAGGTGGCCTCAGCTGGG - Intergenic
1139138736 16:64235338-64235360 GGTCTTAGGAAGCAATAGTTTGG - Intergenic
1140126303 16:72121567-72121589 GCTCTGAGGCAGCCACTGCTTGG + Intronic
1141085079 16:81088175-81088197 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
1141359113 16:83378084-83378106 GCTCTTAGGAAGCAAATGCCTGG - Intronic
1141480064 16:84300439-84300461 GATCCCAGGAAGCCCCAGCTGGG - Intronic
1141943663 16:87295648-87295670 GCTCTTAGGGAGGCAGAGATGGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1144887983 17:18476951-18476973 GCTCTGAGGAAGCAACTCCTGGG + Intronic
1145144225 17:20467352-20467374 GCTCTGAGGAAGCAACTCCTGGG - Intronic
1145791636 17:27631362-27631384 GCTCTGAGGAAGCAACTCCTGGG + Intronic
1146413296 17:32608163-32608185 GCTCTAAGGAAGACACTGGTGGG + Intronic
1147457290 17:40545833-40545855 GCTCTTATGAGACCACTGCTGGG + Intergenic
1147557388 17:41488181-41488203 CAGCTTAGGAAGCCACTGCTGGG - Intronic
1147557969 17:41491636-41491658 GCTGTGAGGAAGCCATTGCTGGG - Intronic
1148902159 17:50886500-50886522 GCTCTTCAGAAACCACATCTTGG - Intergenic
1149660320 17:58331389-58331411 GATCTTAGGAAGCCACAAGGAGG - Intergenic
1149905385 17:60521661-60521683 GCTCTTAGGGAGACAGAGGTGGG - Intronic
1150209619 17:63434992-63435014 CGGCTCAGGAAGCCACAGCTGGG + Intronic
1150481598 17:65515603-65515625 CCTCTGAGCAAGCCAGAGCTGGG + Intergenic
1151816413 17:76473583-76473605 GCCCACAGGAAGCCGCAGCTCGG + Intronic
1152380384 17:79939283-79939305 GCTCTTAGGCAGACAGACCTGGG + Exonic
1152419246 17:80183162-80183184 GCTCTTAGGAGGCGACAGAGCGG + Intronic
1156867795 18:41908130-41908152 GGTCTAAGATAGCCACAGCTGGG + Intergenic
1158448615 18:57543230-57543252 GCTCTTAGGAAGGTAAAGCCAGG + Intergenic
1159117624 18:64133526-64133548 GCTGTGAGGAGGCCACAGATAGG + Intergenic
1160565441 18:79784118-79784140 GGTCTGAGGACGCCACAGTTTGG - Intergenic
1160875993 19:1296374-1296396 GCTTGGTGGAAGCCACAGCTAGG + Intronic
1161483333 19:4521727-4521749 GGTGTTGGGAAACCACAGCTTGG - Intergenic
1162752444 19:12837012-12837034 GCTCTTAGGAAGTCACTGTAGGG - Intronic
1163520926 19:17791321-17791343 GCAGTTAGGAGGCCACACCTGGG - Intergenic
1163659708 19:18569384-18569406 GGACTGAAGAAGCCACAGCTAGG - Intronic
1166682967 19:44779220-44779242 GCTCTTTGGGAGGCCCAGCTGGG + Intronic
1167108538 19:47445665-47445687 TGTCTTCTGAAGCCACAGCTGGG + Intronic
925275064 2:2643025-2643047 GGGCTTGGGAAGCCCCAGCTAGG + Intergenic
927504167 2:23602499-23602521 ACTTTTAGGAAGCCACAACAGGG + Intronic
931028394 2:58140764-58140786 GCTCTTTGGAAGCAAAACCTTGG + Intronic
931737724 2:65212275-65212297 GCTCTTAGGGAGGCAGAGGTGGG - Intergenic
935550997 2:104453902-104453924 GTTCTTCGGAACCCACAGATAGG + Intergenic
937992882 2:127674179-127674201 GCTCTTGGGGAGCCCCAGCCCGG - Intronic
938268972 2:129951939-129951961 GCTCTTAGGGAGGCAGAGGTGGG + Intergenic
938968646 2:136410654-136410676 GCTCTGAGGAAACCCCAGCTTGG + Intergenic
940191861 2:151049376-151049398 TCTCTTTGCAAGCCCCAGCTGGG - Intergenic
942127515 2:172842123-172842145 GTTCTTAAGAAGACACAGCATGG + Intronic
945799698 2:214412210-214412232 TCTCTTTGTAAGCCACAGGTAGG - Intronic
947824578 2:233096403-233096425 GCACTTTGGAAGGCAGAGCTGGG + Intronic
948473510 2:238202424-238202446 GCTCTTAGAAAGCGAAGGCTGGG + Intronic
948499578 2:238381911-238381933 GCGGGTAGGAAGCCACAGATGGG + Intronic
948900867 2:240956314-240956336 GCTCGTAGAAAAGCACAGCTGGG + Intronic
948938607 2:241184745-241184767 GCTTTTAGGAAGGCAGAGGTGGG - Intergenic
1169404354 20:5311193-5311215 TCTCTTAGCAAGTCATAGCTGGG - Intronic
1169508734 20:6241608-6241630 GGACTGAGGAAGCCACTGCTAGG - Intergenic
1170095401 20:12640481-12640503 GCCCTTTGGAATGCACAGCTTGG + Intergenic
1170465235 20:16616918-16616940 GCTCTGAGAAAGTCACAGCCAGG + Intergenic
1171381432 20:24737155-24737177 GATCTCAGGAAGCTCCAGCTGGG - Intergenic
1172126369 20:32627299-32627321 GCTCTGGGGAAGCTGCAGCTGGG + Intergenic
1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG + Intergenic
1176334482 21:5583346-5583368 GCTATTAAGAACCCACAGTTGGG + Intergenic
1176393275 21:6237602-6237624 GCTATTAAGAACCCACAGTTGGG - Intergenic
1176468144 21:7078572-7078594 GCTATTAAGAACCCACAGTTGGG + Intronic
1176491705 21:7460350-7460372 GCTATTAAGAACCCACAGTTGGG + Intergenic
1176508937 21:7678033-7678055 GCTATTAAGAACCCACAGTTGGG - Intergenic
1176676098 21:9778838-9778860 GCTCTTTGGGAGCCACTGGTTGG + Intergenic
1180464789 22:15601680-15601702 GCTCTTAGGGAGGCAGAGGTGGG - Intergenic
1180842976 22:18967857-18967879 GTTCCTAGGAAGCCCCAGCAGGG - Intergenic
1180877967 22:19183896-19183918 GCTCTGAGGAAGGCACTGATGGG + Intronic
1181476162 22:23168936-23168958 GCTCACTGGAAGCCACAGCCTGG + Intergenic
1182526900 22:30926227-30926249 GCTGTTTGGACGCCACAGCCAGG + Intronic
1184991700 22:48174642-48174664 TCTCTGGGGAAGCCCCAGCTGGG + Intergenic
1185069046 22:48646401-48646423 GCTCGATGGAAGCCAGAGCTGGG - Intronic
952733325 3:36663182-36663204 CCTTTGAGGAAGGCACAGCTGGG - Intergenic
954203548 3:49040359-49040381 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
954399863 3:50313337-50313359 GCTTTTAAGAAACCACAGCTAGG - Intergenic
956224029 3:66935917-66935939 GCTCTGTAGAAGCCACAGCATGG - Intergenic
956826763 3:73004285-73004307 GCTCTTAGGGAGGCACAGGCGGG - Intronic
960356841 3:116664022-116664044 GCTCTTCAGTAGCCACAGCTGGG + Intronic
961173469 3:124815578-124815600 CCTCTGAGGATGCCAGAGCTGGG - Intronic
961614474 3:128168010-128168032 GCTCTTTGAAAGCCCCAGCAGGG - Intronic
962845860 3:139273322-139273344 GTTTTGAGGATGCCACAGCTGGG - Intronic
964731652 3:159873228-159873250 GCATTTAGGAATCCACTGCTTGG - Intronic
967716629 3:192770061-192770083 GCACTTTGGGAGGCACAGCTGGG + Intergenic
967913630 3:194562056-194562078 GCTCTTAGGGAGGCAGAGGTGGG + Intergenic
968412010 4:397594-397616 GCTCTCAGGGAGGCAGAGCTGGG + Intergenic
969817028 4:9694534-9694556 GCTCTGAGGTGGCCACAGCCTGG - Intergenic
970050229 4:11905932-11905954 GCTGCTAGGAACCCACAGCATGG + Intergenic
971125416 4:23748551-23748573 GTTCTTATGAACCCACAACTTGG - Intergenic
972343604 4:38174476-38174498 GCTCTTATGAAGCGACATTTTGG - Intergenic
972586412 4:40441175-40441197 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
972869143 4:43274428-43274450 ACTCTAAGGAAGCCACAGTTAGG + Intergenic
973588203 4:52413255-52413277 GGTCTTAGGAAGACAAAGATGGG - Intergenic
975895718 4:79087850-79087872 CTTCTGAGGAAGCCACAGTTTGG + Intergenic
978434564 4:108669573-108669595 GCTATCAGCTAGCCACAGCTGGG + Intergenic
979292586 4:118994132-118994154 GGTCTTAGGAGGCCACACGTTGG - Intronic
979539915 4:121869953-121869975 GCCCTCAGGCAGCCACGGCTAGG + Intronic
979762112 4:124419219-124419241 GCTCTTAGGGAGGCAGAGGTGGG - Intergenic
983937495 4:173512287-173512309 CCTCTTAGGGACCCACTGCTAGG - Intergenic
985399432 4:189579908-189579930 GCTCTTTGGGAGCCACTGGTTGG - Intergenic
985434186 4:189913165-189913187 GATCTTGGGATGCCACAACTAGG + Intergenic
987077136 5:14394402-14394424 GCAGTCAGCAAGCCACAGCTGGG - Intronic
987760223 5:22152148-22152170 GGTCTCATGAAGCCACTGCTGGG + Intronic
991894965 5:71385585-71385607 GGTCTCATGAAGCCACTGCTGGG + Intergenic
992914222 5:81432498-81432520 GCACTTTGGAAGGCACAGCCAGG + Intronic
994780936 5:104089042-104089064 GCTCTTAGGGAGGCAGAGGTGGG + Intergenic
996051718 5:118942261-118942283 GCTCTTAGGGAGGCAGAGGTTGG + Intronic
996355463 5:122591669-122591691 GCACCTAGGAAGCCAGAACTGGG - Intergenic
998271860 5:140713776-140713798 GCTCTTAGGGAGGCAGAGGTGGG - Intergenic
1000041603 5:157488726-157488748 GCTCTTAGAAAAACACAGCATGG + Intronic
1004197133 6:13515359-13515381 GCTCGAAGGCAGACACAGCTGGG - Intergenic
1006936708 6:37723674-37723696 GCCCTCAGGAAGCCCCAGGTCGG + Intergenic
1007298551 6:40847981-40848003 GGTCTTAATAAACCACAGCTAGG + Intergenic
1012199275 6:96385525-96385547 GTTCTTTGGGAGCCAGAGCTGGG + Intergenic
1013120288 6:107134825-107134847 GCTCTTAGGGAGGCAGAGCCAGG + Intergenic
1014313116 6:119830252-119830274 GCTCTCAGGAAGCCACATCCTGG - Intergenic
1014947029 6:127510974-127510996 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
1016719868 6:147283594-147283616 GCTCTTCAGAAGCCAGATCTTGG - Intronic
1021858750 7:24884486-24884508 GCTCTCAGGAAGACTCAGCATGG - Intronic
1025175986 7:56802706-56802728 GCTGTTCTCAAGCCACAGCTGGG + Intergenic
1025176180 7:56803575-56803597 GCTCTTCTCAAGCCAGAGCTGGG + Intergenic
1025695808 7:63773716-63773738 GCTGTTCTCAAGCCACAGCTGGG - Intergenic
1027482211 7:78712309-78712331 ACTCTGAGGAAGCCACAGCAGGG + Intronic
1028566582 7:92239521-92239543 TCTCTTTGGATGCCACAGATTGG - Intronic
1029291637 7:99506086-99506108 GCTCCTGGGAAGTCTCAGCTGGG - Exonic
1031431515 7:121676517-121676539 GCTCTTAGAAAGTCTCAGCCAGG + Intergenic
1031883969 7:127226569-127226591 GCTCTTAGGAAGTCCTAGGTGGG - Intronic
1031960115 7:127981478-127981500 GCTCTTGGGATGCCACAGAAAGG + Intronic
1032540331 7:132697566-132697588 GATGGCAGGAAGCCACAGCTGGG + Intronic
1033069829 7:138191960-138191982 GCACTTAGGGAGGCACAGATGGG - Intergenic
1034303831 7:150036009-150036031 GCTCTTAGGACCCCATCGCTGGG - Intergenic
1034541662 7:151762437-151762459 GCTCCCAGTAGGCCACAGCTAGG - Intronic
1035176842 7:157057479-157057501 GCTCTACCGAAGCCACAGCAGGG + Intergenic
1035444574 7:158931698-158931720 GATCTCAGGAAGACACTGCTAGG - Intronic
1035844941 8:2853011-2853033 GCACTCAGGAGGCCACAGCAGGG - Intergenic
1036403159 8:8428625-8428647 GCACTTTGGAAGGCACAGGTGGG - Intergenic
1036960636 8:13241165-13241187 GATGTTATGAAGCCACAGTTTGG - Intronic
1037138542 8:15492688-15492710 GCTCTTAGGGAGGCAGAGGTGGG + Intronic
1038250879 8:25903278-25903300 GCTCTTAGGAAGGCAGAGGCAGG - Intronic
1040665430 8:49625928-49625950 GCTATGAGGAAGGAACAGCTGGG - Intergenic
1044922568 8:97181391-97181413 CCTCTTATGAAACCAAAGCTGGG - Intergenic
1045098662 8:98824927-98824949 GATCTTAGGAAGCCAAATCTAGG - Intronic
1047187656 8:122648689-122648711 GCTCTAAGGCAGCCACAGTATGG + Intergenic
1050581434 9:7061612-7061634 GCTCTGAGGAGCCCACAGCCAGG - Intronic
1056019164 9:82423548-82423570 GCACTTAAGAAGCCACAGGCAGG + Intergenic
1059163798 9:112060120-112060142 GCTCTTAGGAAGCAGGAGATAGG - Intronic
1059958435 9:119542282-119542304 GCTCTTAGCAAACCACAGGCTGG - Intergenic
1061243198 9:129386348-129386370 GCACTTAGGATGTAACAGCTGGG + Intergenic
1062462419 9:136667467-136667489 GCTCTCAGGAAGCCTCACCCGGG + Intronic
1185686504 X:1933292-1933314 GCTCTTTGGAAGGCAGAGGTGGG + Intergenic
1186409867 X:9337156-9337178 GCTCTCAGGAGGGCCCAGCTGGG + Intergenic
1187831408 X:23385575-23385597 ACTCTCAGAAAGTCACAGCTGGG + Intronic
1188469216 X:30518351-30518373 GTTCTTAAGAGGCCACAGCCTGG + Intergenic
1189280745 X:39818818-39818840 GCTCTGAGAAAGCCTCAGCCAGG + Intergenic
1195965742 X:110428611-110428633 GGTTTTAGAAAGCCACATCTTGG - Intronic
1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG + Intergenic
1199213759 X:145244167-145244189 GCTCACAGGAAGCCACAGCCAGG - Intergenic
1199712242 X:150477596-150477618 GCACTCAGGAAACCACAGCCTGG - Intronic
1202581818 Y:26389706-26389728 GCTAATAGGGAGCCACATCTAGG - Intergenic