ID: 1134046217

View in Genome Browser
Species Human (GRCh38)
Location 16:11103126-11103148
Sequence CCAGAGGTTTGGTGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134046208_1134046217 12 Left 1134046208 16:11103091-11103113 CCTTCTGGCGGAAATGAGGTGAA 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG 0: 1
1: 0
2: 2
3: 13
4: 219
1134046205_1134046217 18 Left 1134046205 16:11103085-11103107 CCCGGACCTTCTGGCGGAAATGA 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG 0: 1
1: 0
2: 2
3: 13
4: 219
1134046204_1134046217 19 Left 1134046204 16:11103084-11103106 CCCCGGACCTTCTGGCGGAAATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG 0: 1
1: 0
2: 2
3: 13
4: 219
1134046206_1134046217 17 Left 1134046206 16:11103086-11103108 CCGGACCTTCTGGCGGAAATGAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG 0: 1
1: 0
2: 2
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134046217 Original CRISPR CCAGAGGTTTGGTGGAAAAT GGG Intronic
906952019 1:50342526-50342548 TCAGATGTTTGGTAGAAAACAGG + Intergenic
908281989 1:62549327-62549349 GGACAGTTTTGGTGGAAAATGGG + Intronic
910400504 1:86833542-86833564 TCAGAGGATTGGTGGGAGATGGG + Intergenic
910996024 1:93105275-93105297 CCCGAGGTTTGCTTGCAAATGGG + Intronic
911609901 1:99949451-99949473 CCAGAGGCCTTCTGGAAAATCGG + Intergenic
911674280 1:100641561-100641583 CCAGGGGTTTGGTGGATGAATGG + Intergenic
911737242 1:101351341-101351363 CCAGGGGCTAGATGGAAAATAGG - Intergenic
912396736 1:109350963-109350985 CAAGAATTTTGGGGGAAAATGGG - Exonic
913737766 1:121805034-121805056 CCAAAAGGTTGTTGGAAAATGGG + Intergenic
914385061 1:147160663-147160685 CCACAGGTTTTGTGGAAATGAGG + Intronic
916475672 1:165166357-165166379 CCAGAGTGTTGGTGGTAAGTGGG + Intergenic
919293512 1:195664151-195664173 CCAGAGGTTTGGGCCAAAACTGG - Intergenic
921186997 1:212678706-212678728 CCATGGGTTTGCTGGAAAAGAGG - Intergenic
921314541 1:213877845-213877867 CCAGAGCTTTGGTGTAATTTTGG - Intergenic
921740160 1:218675607-218675629 CCAGGGAAGTGGTGGAAAATTGG - Intergenic
922669749 1:227500290-227500312 CCAGGGGGTTGTTGGAAAAGAGG - Intergenic
923230439 1:231981620-231981642 CCAGAGGTTTTTTGGACTATAGG + Intronic
924428215 1:243973198-243973220 CCGGGGGTTTGGTGGAAAGGAGG + Intergenic
924769479 1:247066461-247066483 CCAGAGGTTTGGTGCAGTATTGG + Intronic
1062969748 10:1637995-1638017 AGAGAGGTTTGGGGGAAAATGGG + Intronic
1063158731 10:3403530-3403552 CCTGAGGAGTGGGGGAAAATAGG + Intergenic
1064366530 10:14713547-14713569 CCAGAATTTTGGTGCACAATAGG - Intronic
1064935917 10:20679029-20679051 CCAGAGGATGGGAGGAAAAAGGG - Intergenic
1068680364 10:59812933-59812955 GCAGAAGTTTGATGTAAAATGGG - Intronic
1071882056 10:89910440-89910462 GCAGAGGTTTGGAGGAAAGAAGG + Intergenic
1071902885 10:90139830-90139852 CCACATGTGTGGTGGAAAAGTGG - Intergenic
1075641034 10:124064746-124064768 CCAGTGGTGTTGGGGAAAATGGG - Intronic
1076752969 10:132552932-132552954 TCAGAGCCTTGGTGGAATATTGG + Intronic
1076753006 10:132553105-132553127 TCAGAGCCTTGGTGGAATATTGG + Intronic
1076753032 10:132553219-132553241 TCAGAGCCTTGGTGGAATATTGG + Intronic
1076753045 10:132553276-132553298 TCAGAGCCTTGGTGGAATATTGG + Intronic
1076753149 10:132553799-132553821 TCAGAGCCTTGGTGGAATATTGG + Intronic
1076753175 10:132553913-132553935 TCAGAGCCTTGGTGGAATATTGG + Intronic
1077945212 11:6889888-6889910 TCAGAAGGTGGGTGGAAAATGGG + Intergenic
1079095032 11:17504517-17504539 CCTGAGGCTTGGTGGCAGATGGG + Intronic
1079656902 11:22995915-22995937 AAAGGGGTTAGGTGGAAAATGGG + Intergenic
1082735264 11:56847953-56847975 ACAGAGGACAGGTGGAAAATAGG + Intergenic
1086279195 11:85166166-85166188 CAAGAGATTGGGTGGCAAATAGG - Intronic
1087514668 11:99142728-99142750 CCAGAGGTTTGGTGTCAGAATGG - Intronic
1088127060 11:106440021-106440043 CCAAAGGGTTGGTGGAAACAGGG - Intergenic
1091210698 11:133855619-133855641 AGAGAGGGTTGGGGGAAAATAGG - Intergenic
1092830498 12:12439961-12439983 CCAGATGTTTCCTGGAAATTTGG + Intronic
1092945050 12:13445565-13445587 CAAGTGGTTTGGGGGAAACTGGG - Intergenic
1093109976 12:15139700-15139722 CCAGGGGTTTTGTGCAAATTTGG + Intronic
1093893447 12:24550901-24550923 CCAGAGTTTTAGTAGAAAAATGG - Intergenic
1095162499 12:38934290-38934312 TAAGGGGTTAGGTGGAAAATGGG + Intergenic
1096015658 12:48271860-48271882 CAAGAGGTTTGGTAATAAATGGG + Intergenic
1096981927 12:55733041-55733063 CCAGAGGTTGGGTCTGAAATGGG + Intergenic
1097623810 12:61975309-61975331 CCAGAGGTTGGGTGGAAGTGAGG - Intronic
1098682430 12:73373572-73373594 CCAGAGGTTTTTTAGGAAATAGG + Intergenic
1101826318 12:108223207-108223229 CCAGTTGTTTGGTGAAACATTGG - Intronic
1104209726 12:126677105-126677127 CCATAAATTTAGTGGAAAATAGG + Intergenic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1105049318 12:133034469-133034491 CCAGAGGTCAGGTGGCAAGTAGG - Intergenic
1106352752 13:28949615-28949637 CCAGGGGCTGGGAGGAAAATAGG - Intronic
1106517949 13:30471303-30471325 CCATTGGTTTGGTTGAACATGGG - Intronic
1108573223 13:51769953-51769975 CCTGAGGTCTGTGGGAAAATGGG - Intronic
1108779736 13:53814848-53814870 CAAGAGTTTTGGTGCAAATTTGG + Intergenic
1110190055 13:72720107-72720129 CTAGAGTTTGGGTGGAAAATAGG + Intronic
1110477506 13:75933883-75933905 CCACAGGTTTGGTAAGAAATTGG + Intergenic
1110797842 13:79660520-79660542 CCAGGTGGGTGGTGGAAAATTGG + Intergenic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1111834183 13:93367128-93367150 CCAGAAGTTAGGTGAAAAACAGG + Intronic
1112444298 13:99450162-99450184 CCAGGGGATGGGAGGAAAATTGG - Intergenic
1114039085 14:18659747-18659769 CCAGAGATATGGTGGAAGGTGGG - Intergenic
1119443189 14:74642763-74642785 CCAGATGCTTGGTGGTAATTAGG + Intergenic
1121063064 14:90934761-90934783 CCAAAGGTTGGGGGGTAAATAGG - Intronic
1121224353 14:92310357-92310379 CCAGATGGTTGATGCAAAATGGG - Intergenic
1122226055 14:100280582-100280604 CCTGAGGATTTGAGGAAAATCGG + Exonic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125381335 15:39090644-39090666 CCAGAGCTCTGTTGGAAAAGTGG + Intergenic
1127663907 15:61125768-61125790 TTAGGGCTTTGGTGGAAAATAGG - Intronic
1128359432 15:66950753-66950775 CCAGGGCTTGGGTGGAGAATAGG + Intergenic
1131815510 15:96217407-96217429 CCAGAGGGTTGATGGAAAATGGG - Intergenic
1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG + Intronic
1134899590 16:17925182-17925204 GCTGAGGTTTGGTGGACAACTGG + Intergenic
1135525746 16:23212546-23212568 CCAGAGAGTTGGTAGAAAGTGGG + Intronic
1135923619 16:26673102-26673124 CCAGATGTTTGCAAGAAAATAGG + Intergenic
1137294418 16:47076690-47076712 CCTGAGGTTTGGTGGCAGAAAGG - Intergenic
1137330603 16:47491816-47491838 ACAGAGGTTTTTTGCAAAATGGG + Intronic
1137918633 16:52461870-52461892 CCAGAGGCATGGTTAAAAATTGG - Intronic
1138189822 16:55005388-55005410 CCAGGGATTTGGGGGAAAAGAGG - Intergenic
1138962909 16:62048846-62048868 TCAGAGGGTTGAAGGAAAATTGG - Intergenic
1140120713 16:72080965-72080987 CAAGGGGTTCAGTGGAAAATGGG - Intronic
1140920642 16:79534494-79534516 TCACAGGTTTGGTGGATAAAAGG - Intergenic
1144482405 17:15638812-15638834 CTAGAGGTTTGGAGGGAGATGGG + Intronic
1144916278 17:18726220-18726242 CTAGAGGTTTGGAGGGAGATGGG - Intronic
1149181673 17:53945819-53945841 CAAGAGGATTGGTTGAAACTTGG + Intergenic
1150657426 17:67049215-67049237 CCATAGATTTGGGGAAAAATTGG - Intronic
1203192630 17_KI270729v1_random:204300-204322 CCAGAGCTTTGGTGGAGTAGAGG + Intergenic
1203201997 17_KI270730v1_random:3735-3757 CCAGAGCTTTGGTGGAGTAGAGG + Intergenic
1153557286 18:6328879-6328901 ACAGAGCTCTGCTGGAAAATGGG + Intronic
1156293192 18:35767315-35767337 CTGGAGGGTTGGGGGAAAATAGG - Intergenic
1156400797 18:36737953-36737975 CAAGAGTTTTGTTGGAAGATGGG - Intronic
1158239361 18:55359770-55359792 GCAGAAGTTTTGTGGAAAAGAGG - Intronic
1159191503 18:65050327-65050349 CCTCAGGATTGGTGAAAAATTGG + Intergenic
1160233573 18:77067741-77067763 TGAGAGATTGGGTGGAAAATTGG - Intronic
1161775788 19:6261371-6261393 CCAGAGGGTTTGTGGAAAAGTGG + Intronic
1162272971 19:9631294-9631316 CAAGGGGTTAGGTGAAAAATGGG - Intronic
1165160896 19:33815556-33815578 GCAGGGGTTTGGTGGGAAACGGG - Intronic
1165460890 19:35943785-35943807 GCAGAGGATTGGGGCAAAATTGG + Intronic
1168073951 19:53968836-53968858 CCACAGGTTTGGGGAAAAACAGG + Intronic
926406553 2:12558831-12558853 CCAGCTGTAAGGTGGAAAATAGG + Intergenic
927123244 2:19989126-19989148 CCACATGTTTGGTAGTAAATTGG - Intronic
928495549 2:31828481-31828503 CCATATGTTTGGGAGAAAATAGG - Intergenic
929300800 2:40301758-40301780 CCATAGGTTTTGGGGAAAACAGG + Intronic
930434976 2:51329368-51329390 CCAAAGGCTTGTGGGAAAATTGG + Intergenic
931790115 2:65657407-65657429 TCAGATTTTTAGTGGAAAATGGG + Intergenic
932327756 2:70874399-70874421 CCACAGTTTGGGAGGAAAATAGG - Intergenic
933177848 2:79195898-79195920 GCAGAGGTAGGGTGGAAAGTAGG + Intronic
934674401 2:96239480-96239502 CCAGAGGGGTGGTGGGACATTGG - Intergenic
935958590 2:108401995-108402017 TAAGGGGTTAGGTGGAAAATGGG - Intergenic
937237412 2:120439014-120439036 CCACTGGTTTGGTGGAAACAGGG - Intergenic
941357872 2:164514933-164514955 CCAGAGAAGTGGTGGAAAATCGG - Intronic
945509177 2:210679530-210679552 CCATAGTTTCGGTGGTAAATTGG - Intergenic
945920771 2:215752713-215752735 TCAGAGGATAGGAGGAAAATTGG + Intergenic
947912845 2:233812819-233812841 CAAGAGGCTTGGTGCAAAGTTGG + Intronic
1169394925 20:5220612-5220634 CCTGAGGCTTGGGGGAAAAGTGG - Intergenic
1170362542 20:15562374-15562396 CAAGAAATGTGGTGGAAAATGGG - Intronic
1172955481 20:38755015-38755037 CCAGGAGCTTGCTGGAAAATGGG - Exonic
1174498164 20:50964276-50964298 CCAGAATTTGGGTGAAAAATAGG + Intergenic
1175628557 20:60511196-60511218 CCAAAGGTTGGGAGGAATATTGG - Intergenic
1176983542 21:15410160-15410182 TCATAGGTTTGGGGGAAAAATGG - Intergenic
1177461577 21:21418710-21418732 CCAGAGGCTTGGTAGTATATTGG + Intronic
1181331392 22:22094856-22094878 CCAGAGGTTGGGGGGAAGAAGGG + Intergenic
1184205211 22:42998005-42998027 CCAGAGCTTTCCTGGAAAAGAGG + Intronic
950227939 3:11251134-11251156 TAAGGGGTTAGGTGGAAAATGGG + Intronic
950323494 3:12081720-12081742 CCTGAGGATTGGTGGAAGAGGGG - Intronic
950601935 3:14042535-14042557 CGGGAGGTTAGATGGAAAATGGG + Intronic
951278829 3:20722045-20722067 CCAGTGGTCTGTTGGAAACTGGG - Intergenic
951353496 3:21635580-21635602 CCATAGGTTTGGGGGAACAGGGG + Intronic
951770407 3:26249737-26249759 ATAGATGTTTGTTGGAAAATTGG - Intergenic
952581857 3:34843386-34843408 GCAAAGGTTTGGGGGAAGATGGG + Intergenic
957582922 3:82099197-82099219 AGATAGGTTTGATGGAAAATAGG - Intergenic
958138803 3:89533493-89533515 CCAGTGGTTCTGTGGAAAATTGG - Intergenic
958490978 3:94772843-94772865 CCAGGGGTTTGGGGGAAGAACGG + Intergenic
959760072 3:109951484-109951506 CTAGAGGTTTGGAGGGAAATAGG + Intergenic
962314355 3:134349940-134349962 CAAGAGCTTTGGGGGAAAAAAGG - Intergenic
965693878 3:171386343-171386365 CCAAAGTTTTTATGGAAAATAGG - Intronic
965836980 3:172863573-172863595 CCAAAGGTGTGCTGGAAAACTGG + Intergenic
966206238 3:177409490-177409512 ACTCAGGTTTGGAGGAAAATGGG - Intergenic
968185378 3:196630108-196630130 CTGGGGGTTTGGGGGAAAATGGG - Intergenic
969216776 4:5729440-5729462 CCAGAGATTGGGAGGAAAGTGGG + Intronic
970972735 4:22003569-22003591 TCAGAGGTTTGGGGGAAAGAAGG + Intergenic
971802974 4:31316825-31316847 CCTGAATTTTGATGGAAAATGGG - Intergenic
974709843 4:65576235-65576257 CCAAAGGTTTGGAACAAAATTGG - Intronic
975810975 4:78169206-78169228 CCTGAGGTCTGGTAGTAAATGGG + Intronic
976857461 4:89622090-89622112 CAAGAGGTTTGTTGCAAAAAAGG + Intergenic
977328163 4:95603378-95603400 ATATAGGTTTGGTGGAAAGTAGG + Intergenic
979831513 4:125311156-125311178 ACAAAGGTTTGGAGGAAAACTGG + Intergenic
983088081 4:163472102-163472124 CCAGGGGTTTAATGGTAAATGGG + Exonic
986483157 5:8209856-8209878 GCAGAGTTTTGGAGGTAAATAGG + Intergenic
988957823 5:36336753-36336775 CCAGAGGTTTTGTGGAAAGGTGG + Intergenic
989369265 5:40688605-40688627 CCAGAGGTTTTGAGGAACTTAGG - Intronic
992250995 5:74875948-74875970 ACAGAGGTGTCTTGGAAAATGGG + Intergenic
994644677 5:102453523-102453545 CATGAGGTTTTGTTGAAAATTGG + Intronic
998780365 5:145649760-145649782 GTAGAAGTTTGATGGAAAATTGG - Intronic
1000137143 5:158363783-158363805 ACAGAGGGATGGTGGATAATTGG + Intergenic
1001097041 5:168783413-168783435 CCAGAGGAGTGGGGGAAGATGGG + Intronic
1004335935 6:14764510-14764532 CCAGAAATTTTGTGGATAATAGG - Intergenic
1004479089 6:16001681-16001703 CCAGATATTTGGGGGACAATTGG + Intergenic
1004542539 6:16564703-16564725 GTAGAGGATTGGGGGAAAATGGG + Intronic
1004869473 6:19890208-19890230 CTAGACATTTGGTGGAAAACGGG - Intergenic
1005575117 6:27183243-27183265 CAAGGGGTTAGATGGAAAATGGG - Intergenic
1006914981 6:37588182-37588204 CCAGAGATTTGGGGGAAAACTGG + Intergenic
1007979356 6:46134845-46134867 CCAGGGGTTGGGGGGGAAATGGG - Intronic
1008788896 6:55204625-55204647 CAAGAGGTTTGGTGGAAAAATGG + Intronic
1009376220 6:62973334-62973356 GCAGAAGTTAGGTGGAAAACAGG + Intergenic
1011257360 6:85436660-85436682 CCAGAGGTTTGGAGCAAAGAAGG - Intergenic
1017793465 6:157822500-157822522 CGAGAGGTTTGGGGGACAACAGG - Intronic
1018513595 6:164553970-164553992 CCAGTGCGTTGGTGGAAATTGGG + Intergenic
1021950067 7:25765932-25765954 CAAGACGTTTGGAGGAAAAGAGG + Intergenic
1021969193 7:25950857-25950879 CGAGGGGTTTGGGGGAAGATGGG - Intergenic
1022198949 7:28097124-28097146 GCAGAGGTTGGGTGGGAAAGTGG - Intronic
1026987982 7:74566888-74566910 CCAGAGGGGTGGTGGGAAAGAGG - Intronic
1030068146 7:105676347-105676369 CCACAGCTTTGGTGAAAACTGGG + Intronic
1033157707 7:138971081-138971103 CCAGAGCCTTGGCGGAAGATAGG - Intronic
1033451428 7:141465422-141465444 CCTGTGGTTTGGTGGCAAACTGG - Intronic
1034387896 7:150755764-150755786 ACAGAGGTGTGGTGGGAAAAAGG - Intergenic
1034541688 7:151762558-151762580 ACAGGGGTTTGGTGGAAAAGAGG + Intronic
1035343036 7:158176743-158176765 GCGGAGCTCTGGTGGAAAATTGG - Intronic
1036582289 8:10086580-10086602 CCTAAGCTTTGGAGGAAAATAGG - Intronic
1039274101 8:35915772-35915794 CCCGGGGTTTGCTGGAAAAAAGG + Intergenic
1041639857 8:60185268-60185290 CCAGAGGGGTGGTGTAAGATGGG + Intergenic
1042621285 8:70708052-70708074 CTAGAGGTTTACAGGAAAATGGG - Intronic
1043319948 8:78972264-78972286 CCAGAAGTGTGGCTGAAAATTGG - Intergenic
1043700829 8:83286944-83286966 CTAGAGATTTGTTTGAAAATTGG - Intergenic
1043889963 8:85643887-85643909 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043891501 8:85655795-85655817 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043892574 8:85662632-85662654 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043892983 8:85714703-85714725 CCAGAGCTTCGGAGGATAATGGG - Intergenic
1043895670 8:85736157-85736179 CCAGAGCTTCGGAGGATAATGGG - Intergenic
1043897009 8:85745651-85745673 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043899333 8:85764018-85764040 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043900943 8:85776212-85776234 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043902907 8:85791487-85791509 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043904517 8:85803680-85803702 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043906129 8:85815871-85815893 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1043907737 8:85828061-85828083 CCAGAGCTTCGGAGGATAATGGG + Intergenic
1046667915 8:117025231-117025253 CGATAGGTTTGGTTGAAAATGGG + Intronic
1046809129 8:118513830-118513852 CCTCAGTTTTGGGGGAAAATGGG + Intronic
1046937385 8:119897702-119897724 CTTGAGATTTGGTAGAAAATAGG + Intronic
1048076446 8:131076606-131076628 CCACAGGGTTAATGGAAAATAGG + Intergenic
1048487767 8:134864740-134864762 CCAGACGTTTGGTCAAATATTGG - Intergenic
1048807520 8:138254516-138254538 CCAGATGGTTAGGGGAAAATAGG + Intronic
1049060675 8:140273775-140273797 CCACAGGTGTCGTGGAAACTGGG - Intronic
1050208573 9:3227052-3227074 CAAGAGGTCTGGGGGTAAATGGG + Intronic
1050773283 9:9230648-9230670 CCAGCTGTTTGGTGGAGAGTTGG + Intronic
1050899094 9:10922456-10922478 GCAGAGGTAGGGTAGAAAATTGG + Intergenic
1052788958 9:32856186-32856208 CCAGATGATTGGGTGAAAATTGG + Intergenic
1055068837 9:72146401-72146423 ACAGAGGTTTGGAGGAAAGAGGG - Intronic
1055967406 9:81879068-81879090 CCAGAGGCTTGGTGGGGAGTGGG + Intergenic
1056252794 9:84767775-84767797 CCAGATATTTGGGGGAAAAGAGG - Intronic
1056390501 9:86136948-86136970 TCAGAGGTTTGGTGTAAGGTAGG - Intergenic
1057194525 9:93109557-93109579 CCAGAGGATTGCTTGAAACTGGG - Intronic
1057771914 9:97975768-97975790 CCAGAGGTTTGGGGGAAGGGAGG - Intergenic
1058547852 9:106080326-106080348 CCAAAGGGTTGGTGAAAAAAAGG - Intergenic
1060121810 9:120998605-120998627 CCAGAGTTTGGTTGTAAAATGGG - Intronic
1186656914 X:11622508-11622530 CCAGGGGGTTGGGGGAAGATAGG + Intronic
1187273243 X:17797747-17797769 CCAGGCGTTTGATGGAAACTGGG - Intergenic
1187588193 X:20687176-20687198 CCAGAGGCTGGGAGGAAAATTGG - Intergenic
1188548783 X:31338735-31338757 ACAGAGATTTCCTGGAAAATGGG + Intronic
1193757936 X:85431609-85431631 CCAGAGGTATGGTTGGAAGTAGG + Intergenic
1194082589 X:89486892-89486914 CCAGAGGCTTAGGGGAAAAATGG - Intergenic
1196057540 X:111372309-111372331 ACAAAGGGTTGCTGGAAAATTGG + Intronic
1196130223 X:112147558-112147580 CCAGAGGTTTACTTCAAAATGGG - Intergenic
1196260049 X:113568314-113568336 CCAGAGGTTAGGTGGGACAGAGG - Intergenic
1197163237 X:123346931-123346953 CCAGTGGTATGCTGGAAAACTGG + Intronic
1197526279 X:127568084-127568106 TCTGAGGTTTGGGGGAAAACTGG + Intergenic
1198499062 X:137224554-137224576 CAAGAGGTTTGGTTGTGAATAGG - Intergenic
1200008532 X:153104188-153104210 TCAGTGGTTGGGTGGAAAATAGG + Intergenic
1200207487 X:154327861-154327883 CCAGAGGTTTAATGGTAAACAGG - Exonic
1200435237 Y:3142773-3142795 CCAGAGGCTTAGGGGAAAAATGG - Intergenic
1201495151 Y:14584691-14584713 CTGGCAGTTTGGTGGAAAATTGG + Intronic