ID: 1134047009

View in Genome Browser
Species Human (GRCh38)
Location 16:11108410-11108432
Sequence ACCAGGGAGTTAAACCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134047002_1134047009 11 Left 1134047002 16:11108376-11108398 CCAGGAGCATGGAGGTGGCTTCA 0: 1
1: 0
2: 2
3: 22
4: 219
Right 1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1134046997_1134047009 26 Left 1134046997 16:11108361-11108383 CCTTGCCAAGGCAGTCCAGGAGC 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1134046999_1134047009 21 Left 1134046999 16:11108366-11108388 CCAAGGCAGTCCAGGAGCATGGA 0: 1
1: 0
2: 2
3: 25
4: 211
Right 1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134047009 Original CRISPR ACCAGGGAGTTAAACCCTCA GGG Intronic
902451167 1:16498151-16498173 ACCAGGGAGTGACCCCCACAGGG + Intergenic
905618623 1:39420585-39420607 ACCAGGGAGGGAAAGCCCCAGGG - Intronic
910425929 1:87120088-87120110 ACAAGTGTGTTGAACCCTCAGGG - Intronic
915838510 1:159197198-159197220 ACCTGGGACCTAAGCCCTCAGGG - Intronic
917753638 1:178077498-178077520 TTTAGGAAGTTAAACCCTCAGGG + Intergenic
920161439 1:204001388-204001410 CACAGGGATTTACACCCTCAGGG - Intergenic
922235115 1:223716852-223716874 TCAAGGGTGTTAAAACCTCAGGG - Intronic
923683793 1:236140788-236140810 TGCAGGAAGTTACACCCTCATGG + Intergenic
1063063757 10:2587658-2587680 TCCAGGTATTTAAACCCTGATGG - Intergenic
1072207421 10:93216587-93216609 ACAAGGCATTCAAACCCTCAGGG + Intergenic
1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG + Intergenic
1078015753 11:7612874-7612896 ACCAGGGGTTTAAAACCACAGGG + Intronic
1080961283 11:37163531-37163553 ATCAGGAAATGAAACCCTCAGGG + Intergenic
1081780470 11:45707490-45707512 AACTGGCAGATAAACCCTCATGG - Intergenic
1081929332 11:46857898-46857920 AACAGGAAGTTTGACCCTCATGG + Exonic
1085356567 11:75843569-75843591 ACCAGGGAATGAAACCAACAAGG - Intronic
1088439313 11:109851412-109851434 GCCAGGGAGTAAAACCCACTGGG + Intergenic
1090268233 11:125368226-125368248 ACCAGGGAGATGACCCCTAATGG + Intronic
1093230252 12:16535052-16535074 ATAAGGGAGTCAAACCCTAAGGG - Intronic
1096750446 12:53755663-53755685 ACCAGGGAGCAAAACCCACCAGG - Intergenic
1100007189 12:89908687-89908709 TCCAGGTAGTTGAACCCGCACGG + Intergenic
1101102563 12:101408349-101408371 ACCAGGGACTTATTCCCTCGAGG + Intergenic
1106795668 13:33202503-33202525 ACCAGGGAGTCAAAGCAGCATGG + Intronic
1108912913 13:55578180-55578202 ACCAGGTAGTTCTGCCCTCAGGG - Intergenic
1113406392 13:110044711-110044733 ACCAGGGAGTCTAACTCACACGG + Intergenic
1117620019 14:57576066-57576088 ATCAGGTTGATAAACCCTCATGG - Intronic
1121713618 14:96057181-96057203 ATGAGGGGGTTAAGCCCTCACGG - Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126314296 15:47352836-47352858 AGCAAGGAGATAAACCCTCTTGG - Intronic
1130246653 15:82257071-82257093 ACTAGAGAGTTAAACCATCTGGG + Intronic
1130454007 15:84086269-84086291 ACTAGAGAGTTAAACCATCTGGG - Intergenic
1131621734 15:94075274-94075296 ACAAGGGAGTGACATCCTCAAGG + Intergenic
1132346845 15:101113780-101113802 CCCAGGGAGTTGAGACCTCAGGG - Intergenic
1133916837 16:10116703-10116725 AACAGGGATTTAACCCCACAAGG + Intronic
1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG + Intronic
1135386709 16:22048022-22048044 ACGAGGGAGTTAAGTCCTAAAGG + Intronic
1137962594 16:52897980-52898002 GCCAGGCAGTTAATGCCTCAGGG + Intergenic
1141289282 16:82702800-82702822 ACCAGGGAGCTGAACCCTGGGGG - Intronic
1146609420 17:34291144-34291166 ACCAGGGGCTGAACCCCTCAGGG - Intergenic
1147650361 17:42058499-42058521 ACCAGGGAGCTCCACCCTAAGGG + Intronic
1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG + Intergenic
1157179426 18:45483178-45483200 AGAAGCGATTTAAACCCTCAAGG + Intronic
1159197217 18:65132997-65133019 ACCAGGTAGTTAAACCCTGGAGG - Intergenic
1160099552 18:75907221-75907243 ACCATAGAGTTACACCTTCAAGG - Intergenic
1160541382 18:79625526-79625548 ACCTGGGAATTAATCACTCACGG - Intergenic
1162128859 19:8513324-8513346 ACCAGGAGGAGAAACCCTCAGGG - Exonic
1165826947 19:38710951-38710973 ACCACGGAGTAAGACCCTAAGGG - Intronic
926059888 2:9798641-9798663 ATCAGTGTGTTTAACCCTCAGGG + Intergenic
935333142 2:101991921-101991943 AGCAGGGATTTATACCCTCTTGG - Exonic
935669791 2:105545297-105545319 ACAAGGCAGTTAACTCCTCACGG + Intergenic
938053350 2:128195041-128195063 ACCACAGAGTTTAACCTTCATGG - Exonic
944568243 2:201013656-201013678 ACAAAGAAGTTATACCCTCAAGG - Intronic
948041168 2:234902663-234902685 CCCAGGGAGTTTTATCCTCAGGG - Intergenic
1170781562 20:19430175-19430197 TCCAAGGAGTCAAACCCTAAAGG - Intronic
1174412194 20:50343527-50343549 GCCAGGGAGCTAAGCCCTCCAGG + Intergenic
1177411860 21:20739569-20739591 AACAGGAAGTCACACCCTCAGGG + Intergenic
1179027678 21:37693444-37693466 ACCAGGAAATCAAACCCTCAAGG + Intronic
1183031834 22:35112336-35112358 GCCAGGGAGGTTAACCCTAAAGG - Intergenic
1183540823 22:38428393-38428415 ACCAGGAAGCTAAAGCCACAAGG + Intronic
1183727368 22:39597259-39597281 ACCAGGGAGGTCAGGCCTCAAGG - Intronic
949794907 3:7838751-7838773 ACCAATGAGCTAAACCTTCATGG + Intergenic
950648251 3:14391240-14391262 AGCAGGGCATTAAACCCTGAAGG + Intergenic
957208977 3:77236308-77236330 ATCAGGCAGATAAACCCTCTAGG + Intronic
957291632 3:78284169-78284191 ACCACTGAATTAACCCCTCAGGG - Intergenic
967036559 3:185652478-185652500 ACCAGGGAGTCAAAAGCTCTAGG + Intronic
984382680 4:179015493-179015515 TTCAGGGGGTTACACCCTCAGGG + Intergenic
989765312 5:45075909-45075931 GCCAGGGAATTAAAGCCTCCAGG + Intergenic
992717039 5:79521183-79521205 ACCAGGGAGAAAAACTCTGAAGG + Intergenic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
994640485 5:102402322-102402344 ACCAGGGCCTAAAATCCTCAAGG + Intronic
996075958 5:119194633-119194655 ACCAGGAAGTAAAAATCTCATGG - Intronic
1001866551 5:175111042-175111064 ACCACTGAGTTCAAGCCTCAGGG - Intergenic
1004505118 6:16240904-16240926 ATCAGGGAGCTAAACCATCACGG - Intronic
1006732915 6:36249724-36249746 AACAGGGATGTAAACTCTCATGG - Intronic
1008463880 6:51807923-51807945 ACTAGGGAGTTATAGCCTAAGGG + Intronic
1009929790 6:70163722-70163744 ACCAGGGAGTTCCAGCCACAGGG + Intronic
1010838500 6:80618692-80618714 AGCCAGGAGTTGAACCCTCAAGG + Intergenic
1010941016 6:81917646-81917668 AGCAGGGATTTAGCCCCTCAGGG - Intergenic
1013313960 6:108923792-108923814 ACCAGGGCCTAAAACCCTGAGGG - Intronic
1022559971 7:31337235-31337257 CCCAGGATGTTTAACCCTCATGG + Intergenic
1024163710 7:46708062-46708084 ACCAGTGATTTAAACAATCATGG - Intronic
1024176262 7:46844134-46844156 ACCTGGGATTTTAATCCTCAGGG - Intergenic
1024414860 7:49095075-49095097 ACCAGGGAGTTCAGCCAGCATGG - Intergenic
1024949427 7:54843800-54843822 CCCAGGAAGTTAAACCACCAGGG - Intergenic
1027669249 7:81075499-81075521 ACCATGGAGTTGTACCCACATGG - Intergenic
1030531665 7:110718575-110718597 ACCAGGGAGTTAAAAGCACTTGG + Intronic
1032550770 7:132781895-132781917 CCCACGGAGTAAATCCCTCAGGG + Intergenic
1035953000 8:4044784-4044806 TCCAGGGTGGTACACCCTCAGGG - Intronic
1043762513 8:84085464-84085486 ACCAAGGAGATAAACACCCAAGG - Intergenic
1047515331 8:125549320-125549342 ATCAGGGAGTTAAACCCAAGTGG + Intergenic
1047756995 8:127926535-127926557 ACCATGGAGTTTACCCCACATGG - Intergenic
1049990144 9:982454-982476 ACCCGGGAGTTCATCCATCAGGG - Intronic
1051310532 9:15766235-15766257 ACAAGGGACTTTAACACTCACGG - Intronic
1057830532 9:98402787-98402809 TCCAGGGAGTTAACGCCTCCAGG - Intronic
1057840279 9:98480754-98480776 TCCAGGGAGCTAAAACCCCAGGG - Intronic
1059609041 9:115871815-115871837 ACCTGGGAATTAAAACCTAAAGG - Intergenic
1060462681 9:123872908-123872930 AGCAGGGAATTAATCCCTCTAGG + Intronic
1187129609 X:16489622-16489644 AACAGGGACTTAATCCCTCCTGG - Intergenic
1188377786 X:29454114-29454136 TCCAGGGAGTAAAACCCTCCAGG - Intronic
1189993885 X:46620461-46620483 ACCAAAATGTTAAACCCTCATGG - Intronic
1193733225 X:85126670-85126692 ACCAGGGTGTAAAATTCTCAAGG + Intergenic
1194127059 X:90032001-90032023 TCCAGGGAGTTCAACCAGCAAGG + Intergenic
1197873830 X:131083966-131083988 TCGAGTGAGTTAAACCCTCCAGG + Exonic