ID: 1134050829

View in Genome Browser
Species Human (GRCh38)
Location 16:11136065-11136087
Sequence CTGGGCAAATACTCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134050829_1134050836 26 Left 1134050829 16:11136065-11136087 CCAGCAGCAGAGTATTTGCCCAG 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1134050836 16:11136114-11136136 CAGCACAAGCCAAAGAGTATGGG 0: 1
1: 0
2: 1
3: 14
4: 170
1134050829_1134050835 25 Left 1134050829 16:11136065-11136087 CCAGCAGCAGAGTATTTGCCCAG 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1134050835 16:11136113-11136135 CCAGCACAAGCCAAAGAGTATGG 0: 1
1: 0
2: 1
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134050829 Original CRISPR CTGGGCAAATACTCTGCTGC TGG (reversed) Intronic
901811853 1:11771903-11771925 CTGGGCTGATACACTGATGCAGG + Intronic
905465871 1:38152724-38152746 CTGGGCACAGACTCTGCCCCTGG + Intergenic
912705724 1:111910545-111910567 CTGGGGAGATACTCATCTGCAGG + Intronic
912960342 1:114190350-114190372 ATGGCCAAATGCCCTGCTGCAGG + Intergenic
914678248 1:149920213-149920235 CTGGCCAAATGCTCTCCTGCTGG - Intergenic
918231139 1:182533514-182533536 CAGGGCAGATCCTCTGCTGCAGG - Intronic
918298464 1:183180490-183180512 CTGGGTAAATTCTCTGAGGCTGG - Intergenic
919750746 1:201036476-201036498 CTGGGCAGCGACCCTGCTGCGGG + Intergenic
920298712 1:204975564-204975586 CTGGGCAACTCCCCTGCTTCAGG + Intronic
920530439 1:206698011-206698033 CTGGGAAAATAACCTGATGCTGG + Intronic
920845622 1:209590825-209590847 CTGTGCGGATACACTGCTGCTGG - Intronic
1065915344 10:30350308-30350330 CCGGGGGAATACACTGCTGCTGG + Intronic
1068385273 10:56317928-56317950 CAGTGAAAATTCTCTGCTGCTGG - Intergenic
1070280137 10:75042744-75042766 CTGACCAAATAGTCTGCTGCAGG - Intronic
1070771763 10:79086350-79086372 CTGGGCACCTTCTCTGCTCCAGG - Intronic
1075810891 10:125223996-125224018 CTGGGCAAAATCTCAGCTGATGG - Intergenic
1076381760 10:130028434-130028456 CTGGGCAAGTCCTCAGCAGCTGG + Intergenic
1076822362 10:132945793-132945815 CTGGGCCAACATTCTCCTGCGGG - Intergenic
1079317884 11:19425011-19425033 CTGGGCATATACTATGCTTGAGG + Intronic
1085739477 11:79066503-79066525 CAGGGCACCTACTCTGCAGCAGG - Intronic
1089750165 11:120645871-120645893 CCGGGCAATTACCCTCCTGCCGG + Intronic
1092089408 12:5792027-5792049 CTGTGCAAATACTGTGATGATGG - Intronic
1093089076 12:14901532-14901554 CTTCCCAAATACTCTGCTTCGGG + Intronic
1098678003 12:73315573-73315595 CTGTGCAAATACCTTGGTGCAGG - Intergenic
1101396979 12:104356934-104356956 CTTGGCAAAAACTGCGCTGCTGG - Intergenic
1106230847 13:27820155-27820177 GAGGCCAAATACTCTGCTGCTGG - Intergenic
1106424120 13:29609647-29609669 CAGGGCAAATATCCTGCTGTAGG - Intergenic
1107308059 13:39044343-39044365 CTGGGTAATTACTCTGGGGCTGG + Intronic
1107763042 13:43702410-43702432 GTTGGCTAATACTCTACTGCAGG + Intronic
1110162631 13:72397586-72397608 CTGGACAAAGACACTGCTGCAGG - Intergenic
1110702506 13:78565677-78565699 CTGAGCAAGTGCTATGCTGCAGG - Intergenic
1111009402 13:82292392-82292414 TTGGGTAAAAACTTTGCTGCAGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112620185 13:101046988-101047010 CTGGGCAGATAAACAGCTGCAGG - Intergenic
1117656571 14:57961969-57961991 CTGGGCATGTACCCTGCTCCAGG - Intronic
1124706925 15:31974211-31974233 CTGGGCCCATGCTCTGTTGCAGG - Intergenic
1132318884 15:100910462-100910484 CTGAGCACAGACTCTGCAGCAGG + Intronic
1132729698 16:1355415-1355437 CTTGGCAGACACTCTTCTGCGGG - Intronic
1133434197 16:5765263-5765285 CTGGGGGAGTGCTCTGCTGCTGG - Intergenic
1134050829 16:11136065-11136087 CTGGGCAAATACTCTGCTGCTGG - Intronic
1134063175 16:11211150-11211172 CTGGGCAAAGACTGTCCTGGAGG - Intergenic
1135989152 16:27206885-27206907 CTGGGGAAACACTCTCTTGCTGG - Intronic
1138351890 16:56350475-56350497 CTGGGCAAAAACTCTGCTTTGGG - Intronic
1139500149 16:67356552-67356574 CTGGGCAAATCCTGTGTTGGGGG + Intronic
1142534504 17:605165-605187 CTGGGCATCCACTCTGCTCCAGG + Intronic
1143131009 17:4676886-4676908 CTGGGCTTAGAGTCTGCTGCTGG - Intronic
1144388889 17:14775355-14775377 CTAGGCAATTCCTGTGCTGCTGG - Intergenic
1146530498 17:33604073-33604095 CTGGTCAGAGTCTCTGCTGCAGG + Intronic
1153575093 18:6512061-6512083 CTGGGGACATACACTGCTGGAGG - Intronic
1154081280 18:11259481-11259503 CTGAGCATATATTCTGCTGTGGG + Intergenic
1154221565 18:12459387-12459409 GTGAGCAAATACTCTTCTGATGG + Intronic
1155391677 18:25344621-25344643 CTGGGAAAATACTTAGCTACAGG + Intronic
1155586806 18:27375801-27375823 CTGGTCAGATACTAAGCTGCAGG + Intergenic
1157094416 18:44674441-44674463 CTGGGCATATACTGGGCTCCAGG + Intergenic
1158540966 18:58354219-58354241 GTGGCCAATTACTCAGCTGCTGG - Intronic
1159068282 18:63593521-63593543 CTTGTCAAATCCTCTGCTGTGGG - Intronic
1160089636 18:75814383-75814405 CTGGGAAAATCCACAGCTGCTGG - Intergenic
1162555857 19:11385044-11385066 CTGTGCAAACACTCAACTGCTGG - Intronic
1163923337 19:20313924-20313946 CTGGGCTAGTGCTCTGATGCAGG - Intergenic
1164606331 19:29601061-29601083 CTGGTCAAACCCTCTCCTGCTGG - Intergenic
1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG + Intronic
928097634 2:28414107-28414129 CTCTGCAAAGACTCTGCTGCTGG + Exonic
932588111 2:73044861-73044883 CTGTTCAAATTCTGTGCTGCTGG - Intronic
936069495 2:109356191-109356213 CTGGGAAAATACTGGGGTGCAGG - Intronic
936683948 2:114805483-114805505 CTGGGCCAAGCATCTGCTGCAGG - Intronic
938610724 2:132945101-132945123 CTGGGGAAAGGCTGTGCTGCTGG + Intronic
938623915 2:133087854-133087876 CTGAGCAATTACTCTGTTGCAGG + Intronic
939451319 2:142378501-142378523 CTGGGCAAGTAGTTTGCTGCTGG + Intergenic
942508418 2:176669200-176669222 CTGGGGAAATACTGTGAAGCTGG - Intergenic
946173597 2:217909483-217909505 CTGGGCTCATGCTCTGCTGAGGG - Intronic
948178732 2:235963533-235963555 CTTGTCAAATACTCTGCTGAGGG - Intronic
948637498 2:239348936-239348958 CTGTGAAAGTCCTCTGCTGCTGG - Intronic
948844873 2:240678231-240678253 CTGGGGAAATACTCTTCACCCGG - Intronic
948848987 2:240696648-240696670 CTGGGGAAATACTCTTCACCCGG + Intronic
1170357509 20:15508278-15508300 CTAGAAAAATACTCTGCTGGGGG + Intronic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1176371150 21:6061959-6061981 CTGACAAAACACTCTGCTGCAGG - Intergenic
1177750819 21:25281817-25281839 CAGGTCAAATACTTTCCTGCAGG + Intergenic
1179752369 21:43476582-43476604 CTGACAAAACACTCTGCTGCAGG + Intergenic
950070595 3:10149018-10149040 CTAGGCAGTTACTCTGCTGGTGG + Intronic
950701985 3:14757270-14757292 CTGGTCAAAGGCCCTGCTGCAGG - Intronic
955101318 3:55852906-55852928 ATGGGCTAATACTCTGTTGCAGG + Intronic
959253909 3:103985655-103985677 CTATGCAGATACTCTGCTCCAGG + Intergenic
959874193 3:111362485-111362507 CTGGTCAAATTATCTGTTGCAGG + Intronic
961080166 3:124020123-124020145 CTGGGCAATTAGTCAGCAGCAGG + Intergenic
963608336 3:147433602-147433624 CTGGGGAAATATTGTGCTGGGGG + Intronic
965608153 3:170517123-170517145 TTAGGCAAATACTGTGCAGCAGG - Intronic
968606930 4:1539963-1539985 CTCGGCAAATGTTCTGCAGCGGG - Intergenic
969947358 4:10798275-10798297 CTGGGCAGATACCCAGCAGCGGG - Intergenic
971878559 4:32337638-32337660 CTGGCAAAATACTCTGCATCAGG - Intergenic
974683058 4:65189478-65189500 CTGGGCAAATTCAAGGCTGCAGG - Intergenic
983033574 4:162834544-162834566 CTGGGCAAATACTGTGATAACGG + Intergenic
983503720 4:168529399-168529421 TTGCGCTAATACTATGCTGCAGG - Intronic
986132361 5:4943075-4943097 CTGGGCAGCCACTCTGGTGCTGG - Intergenic
990852713 5:60225011-60225033 CTGGGAAAATACCCAGATGCTGG - Intronic
991367691 5:65886191-65886213 CTTGGAAAATCCTTTGCTGCTGG + Intergenic
992539121 5:77744376-77744398 TTGGGCTAATACTTTGCTGGGGG - Intronic
993668596 5:90731629-90731651 CTGGTCAAATCCTCTGTCGCTGG - Intronic
996618630 5:125472370-125472392 TTGGGCATTTACTCTGCTCCAGG - Intergenic
1001416309 5:171546705-171546727 CTGTGGAAATCCCCTGCTGCAGG - Intergenic
1004863157 6:19826737-19826759 CTAGGCAAACACGCTACTGCAGG + Intergenic
1005520634 6:26597789-26597811 CTGGGCAAAAACTCTTCAGGTGG + Intronic
1007530355 6:42536464-42536486 CTGGGCAGCCACTCTGGTGCCGG + Intergenic
1007844262 6:44740684-44740706 CTGGGAGAATATTCAGCTGCTGG - Intergenic
1008234231 6:49025326-49025348 CTGTGCAAAGATTCTGGTGCAGG - Intergenic
1010404611 6:75489339-75489361 CTTGGGACATACTTTGCTGCTGG - Intronic
1011034023 6:82953938-82953960 CTGGGAGAATACTCTGCACCAGG - Intronic
1011490881 6:87890647-87890669 CTGTTGAAATCCTCTGCTGCAGG - Intergenic
1011664143 6:89618455-89618477 CTGGGCAGATAGTCGCCTGCCGG + Intronic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1012676101 6:102115087-102115109 CTATGCATATACTCTGGTGCAGG - Intergenic
1018731265 6:166652945-166652967 CCTGGCAAATAGCCTGCTGCTGG - Intronic
1019382370 7:730735-730757 CTAGGCAGCCACTCTGCTGCTGG - Intronic
1020700294 7:11473712-11473734 CAGGGCAAACACTTTGCTGGAGG - Intronic
1020764609 7:12304106-12304128 CAGGACAATTCCTCTGCTGCAGG - Intergenic
1022969768 7:35506051-35506073 CTGGACACTTACTCTGCAGCAGG + Intergenic
1023210506 7:37798966-37798988 CTGTGCCAATTCTCAGCTGCAGG + Intronic
1028842205 7:95440826-95440848 GTGGGCAGAGACTCTTCTGCAGG + Intergenic
1028907422 7:96170906-96170928 CTGGGCAAATAATCTGATAAAGG + Intronic
1029939688 7:104466815-104466837 CTGGGCAAATGCTATGCTGCTGG - Intronic
1030094826 7:105889013-105889035 GTGGGCAAATACTCTTAAGCTGG - Intronic
1030112325 7:106037587-106037609 CTGGGCAGGTTCCCTGCTGCAGG - Intergenic
1030978958 7:116163523-116163545 TTGGGATAATACTCTGCTCCTGG - Intergenic
1032682142 7:134195894-134195916 CTGGGCAATGTGTCTGCTGCAGG - Intronic
1037904215 8:22705907-22705929 GTGGGCAAATACTGGGCTGTAGG + Intergenic
1041643014 8:60222747-60222769 CTGTGCAGACCCTCTGCTGCGGG - Exonic
1047411537 8:124628412-124628434 CTGGGCAAGCATCCTGCTGCCGG - Intronic
1048443073 8:134474312-134474334 CTAGACTAATACTCTGCTGGAGG - Intergenic
1051982875 9:23045776-23045798 TTGGGCAGACACTGTGCTGCAGG + Intergenic
1055733535 9:79303982-79304004 CTGTACAAATCCTCTGCTCCAGG + Intergenic
1199185832 X:144913712-144913734 GTGAGCAAATGCTCTGCTTCTGG - Intergenic
1201571521 Y:15420620-15420642 CGGGGCAGAGACTCTGCTGCTGG - Intergenic