ID: 1134056162

View in Genome Browser
Species Human (GRCh38)
Location 16:11171080-11171102
Sequence CTGTCTTCCCAAATGCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134056158_1134056162 -1 Left 1134056158 16:11171058-11171080 CCCTGGGGTCTGCCTGTACATTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1134056156_1134056162 6 Left 1134056156 16:11171051-11171073 CCCATCTCCCTGGGGTCTGCCTG 0: 1
1: 0
2: 3
3: 47
4: 319
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1134056151_1134056162 23 Left 1134056151 16:11171034-11171056 CCAGTGGATTCCTTTTGCCCATC 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1134056155_1134056162 13 Left 1134056155 16:11171044-11171066 CCTTTTGCCCATCTCCCTGGGGT 0: 1
1: 0
2: 3
3: 23
4: 250
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1134056159_1134056162 -2 Left 1134056159 16:11171059-11171081 CCTGGGGTCTGCCTGTACATTCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1134056157_1134056162 5 Left 1134056157 16:11171052-11171074 CCATCTCCCTGGGGTCTGCCTGT 0: 1
1: 0
2: 4
3: 62
4: 463
Right 1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG 0: 1
1: 0
2: 1
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134056162 Original CRISPR CTGTCTTCCCAAATGCAGAC GGG Intronic
902118653 1:14142907-14142929 CTGTCTTCCCAAGTGTTTACTGG + Intergenic
903798049 1:25945299-25945321 CTTTCTTCCCAACAGCACACTGG + Intergenic
906047685 1:42844762-42844784 CTGTCCTCCCAAATGTGGGCGGG - Exonic
906266671 1:44436271-44436293 CTGTCCTCCCAGATTCAGAATGG - Intronic
906472416 1:46142235-46142257 CTGTCTATCCAAATGCCTACTGG + Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
908267680 1:62395117-62395139 CTGTCTTCCCTGATGGAGACAGG + Intergenic
908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG + Intronic
911360329 1:96867945-96867967 TTGTCTTCCAAACTTCAGACAGG + Intergenic
914902601 1:151719070-151719092 CTGTCTCCCCAATTACTGACTGG - Intronic
914923573 1:151864548-151864570 CAGTCTGGCCAAGTGCAGACAGG - Intergenic
917282733 1:173394560-173394582 TTGTCTTCCCAAATGAGGATTGG + Intergenic
918373334 1:183883070-183883092 CAGTCTTTCAAAATGGAGACTGG + Intronic
919745883 1:201008947-201008969 CTATCTTTGCCAATGCAGACGGG - Exonic
921567786 1:216741074-216741096 CAGTCTTCCCATATGGGGACGGG - Intronic
922001086 1:221479093-221479115 CTGACTTCCCAGCTGAAGACAGG + Intergenic
922613203 1:226944947-226944969 CTGTCTTCAGAAAGGCAGAGAGG - Intronic
1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG + Intronic
1066114820 10:32230308-32230330 CAGTCTGCACCAATGCAGACAGG - Intergenic
1068741514 10:60478051-60478073 CCGTTTGCCCAAATGAAGACTGG - Intronic
1070790117 10:79184124-79184146 CTGTCCTCCCACAGGAAGACAGG - Intronic
1071123493 10:82308207-82308229 CTGTCATCCCAAATTCAGCCTGG - Intronic
1071295330 10:84215200-84215222 CTATCTTTCCAAATGCATCCTGG - Exonic
1071750151 10:88466216-88466238 CTGTCTCCCCATATTCAGAAAGG - Intronic
1077516884 11:3007429-3007451 CTTGGTTCCCAAATGCACACGGG + Intronic
1083355272 11:62061617-62061639 TTCTCTTTCCAAATGCAGAAAGG - Intergenic
1086901724 11:92375161-92375183 CTGTCTCCCAAGATGCAGGCTGG + Intronic
1087464408 11:98486869-98486891 CTGTTTTCCCATATACAGATGGG - Intergenic
1088753974 11:112870112-112870134 TTGTCTTCCTGAATGCAGAAAGG + Intergenic
1089213862 11:116823688-116823710 CTGTCTACCCCAGTGAAGACAGG + Intergenic
1089443237 11:118532839-118532861 CTTTCTTCCCAAACCCAGATGGG - Intronic
1091874765 12:3924716-3924738 CTGTCTGCACAAATAGAGACTGG + Intergenic
1092505152 12:9091200-9091222 CTACCTTCCCAAATGCATCCGGG - Exonic
1092511852 12:9165138-9165160 CTACCTTCCCAAATGCATCCGGG - Exonic
1092797026 12:12121922-12121944 CTGTCTACCAAAATCCAGCCTGG - Intronic
1092908853 12:13127337-13127359 CTGTCATCCAAAATGCAGGCCGG - Intronic
1093164308 12:15788576-15788598 CTGTCTTCCCAAAAGTAAAATGG + Intronic
1093829687 12:23740123-23740145 CTCTCTTCCAAAATGCTGACTGG + Intronic
1096765765 12:53887866-53887888 CTGACTTCCCAAGTGCAGAAGGG - Intergenic
1096799609 12:54101449-54101471 CTGACTTCCTAAATGAAGTCCGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1100964776 12:100000510-100000532 CTCTCTACCCAAATGCACTCAGG - Intergenic
1103372336 12:120429024-120429046 CTGTCGTGGGAAATGCAGACAGG + Intergenic
1104927049 12:132319257-132319279 CTGTCCTCCCCAGTGCAGACAGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106616679 13:31336495-31336517 CTCTCCTGCCAAATGCAGAAAGG - Intergenic
1108249285 13:48549060-48549082 CTGTCCTCCCAAATGCATGTGGG + Intergenic
1110367931 13:74708630-74708652 GTTTCTTCACAAATGGAGACTGG + Intergenic
1112733386 13:102392723-102392745 CTTCCTTCCCAAATTCAAACTGG + Intronic
1113995013 14:16057704-16057726 CTGTCCCCCCAAGTGCAGACCGG + Intergenic
1114697801 14:24643920-24643942 CTGTCTTGCCAAGTGCATAGGGG + Intergenic
1117783429 14:59258078-59258100 CTGCCTTCCCCAAAGCACACAGG + Intronic
1118926424 14:70194147-70194169 CTGGCCTCCCAAATACTGACAGG + Intergenic
1120502552 14:85314619-85314641 CTGTGCTCCCAAATGCACATGGG - Intergenic
1121033390 14:90678806-90678828 ATGTTTTCCAAATTGCAGACTGG + Intronic
1122341171 14:101029463-101029485 CTGACTTCCCAAAAGCAACCTGG + Intergenic
1126389426 15:48130661-48130683 TTGTCTTCCCAAATCAAAACAGG - Intronic
1126502811 15:49365751-49365773 CTGTGTTTCAAAATGAAGACAGG - Intronic
1126631060 15:50736100-50736122 CTGTGTTTCGAAATGAAGACAGG - Exonic
1128186225 15:65645412-65645434 CTGTCTTCTCATCTGCAGATAGG + Intronic
1132238432 15:100239209-100239231 CGGTTTTCCCACATGCAGAATGG + Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1133421457 16:5650436-5650458 CTGTCTCTAAAAATGCAGACTGG - Intergenic
1134056162 16:11171080-11171102 CTGTCTTCCCAAATGCAGACGGG + Intronic
1136573228 16:31108910-31108932 CCGTCTCCCCAGATGCACACAGG - Intronic
1136913786 16:34163197-34163219 CCGTCCCCCCAAGTGCAGACCGG + Intergenic
1136994723 16:35181819-35181841 GTGCCTTCTGAAATGCAGACTGG + Intergenic
1138461626 16:57151746-57151768 CTGGCTCCCCAAATCCAGAGGGG - Intergenic
1138577017 16:57914538-57914560 CTGTCTCCTGAAATGAAGACTGG - Intronic
1143289596 17:5818880-5818902 CTGTTTTCCCAAACACAGAAGGG + Intronic
1143333017 17:6151673-6151695 CTGCCTCCCCAAAGGCAGACTGG + Intergenic
1143625250 17:8106198-8106220 CTGTCTTCCTAAATCCAGTTAGG - Intronic
1145112524 17:20176369-20176391 ATTTCTCACCAAATGCAGACAGG + Intronic
1145968557 17:28939692-28939714 TTCTCTGCACAAATGCAGACAGG + Intronic
1146247702 17:31304560-31304582 CTGTCCTTCCAAATCCAGAAGGG + Exonic
1146651317 17:34608400-34608422 CCGTCTTCCCAACTGTATACAGG - Intronic
1147122449 17:38343656-38343678 CTGTCTTCCCAAGTCAAGCCAGG - Exonic
1147304220 17:39552154-39552176 CTGCCTTCTTAACTGCAGACAGG + Intronic
1147556864 17:41485331-41485353 CTGTTTTCTCAAGTGAAGACTGG + Intergenic
1153815913 18:8790046-8790068 CTGCCTGCCCAACAGCAGACAGG - Intronic
1154044787 18:10894572-10894594 CTCTCTTCCCAAGTGCGGGCAGG + Intronic
1155213308 18:23620837-23620859 CTGATTTCCCATAGGCAGACGGG - Intronic
1157605348 18:48922868-48922890 CAGTCTTCCCACAGGCAGCCTGG + Intronic
1161726459 19:5932154-5932176 CTGTCTTCATAAAAGCAGGCCGG - Intronic
1163435305 19:17292053-17292075 CAGTTTTCCCATCTGCAGACTGG - Intergenic
1165321716 19:35089493-35089515 CTGTTTTCCCAAATGTAAAGTGG - Intergenic
1165736832 19:38182458-38182480 CTGTCTTGCCAAATGTGGAATGG + Intronic
1166214504 19:41326383-41326405 CTGTGTTCCCACATGTAGGCTGG - Intronic
1167550748 19:50159153-50159175 CTGTCTCCCCAAATCAAGCCTGG - Intronic
1168465968 19:56601437-56601459 CTGGCCTCACAAATGTAGACAGG - Intronic
925045677 2:771439-771461 GTGTCTTCTCAAATCCACACAGG + Intergenic
925852919 2:8100405-8100427 GTGTCTCCCCAAAAGCAGGCTGG - Intergenic
925895150 2:8465645-8465667 CTCTCTTCACATATGCACACGGG + Intergenic
926218297 2:10918960-10918982 CTGTCTCCGCACAGGCAGACAGG - Intergenic
926260277 2:11253883-11253905 GTGTCTTCCCCAGAGCAGACAGG + Intronic
927097754 2:19760568-19760590 CTATCTTCCCAAAGACAGGCTGG + Intergenic
927217895 2:20679661-20679683 CTGTCATTCCAAATGCAGTTTGG + Intergenic
927493730 2:23538073-23538095 CTGTTTTCCCAAATACTAACTGG - Intronic
927738781 2:25547593-25547615 CTGTCTTCCCATAAGGATACAGG - Intronic
929147627 2:38720485-38720507 CTGACTTCACAAATTCTGACAGG - Intronic
933676702 2:85063606-85063628 CTGACTACCCAAATGAAAACAGG + Intergenic
933844525 2:86314649-86314671 CTGCCTCCCCAAAAGCACACTGG - Intronic
934974797 2:98793663-98793685 CTGTCTTCCAAAATTCTCACTGG + Intergenic
935151590 2:100441506-100441528 CATTCTTCTCAAATGCACACAGG - Intergenic
937588864 2:123590237-123590259 CTGCCTTCCTTACTGCAGACTGG - Intergenic
938536464 2:132253050-132253072 CTGTCCCCCCAAGTGTAGACCGG - Intronic
941747732 2:169104812-169104834 CTGTCTGCCCAACCTCAGACTGG - Intergenic
942263834 2:174200309-174200331 CTGTCTTTCCATAGGAAGACAGG + Intronic
947445152 2:230157480-230157502 CTGCCCTCCCGAATGCAGCCTGG - Intergenic
1169554859 20:6738499-6738521 CTGTCTTCCCAACTGGAGATAGG + Intergenic
1170159480 20:13297198-13297220 CTGTTTTCCAGAATGCAGAAGGG + Intronic
1170280203 20:14637929-14637951 CTGACTTCCAAAATCCTGACAGG - Intronic
1170283699 20:14681022-14681044 ATGTCTTGCCAAATGTATACTGG - Intronic
1171767233 20:29296986-29297008 CCGTCCTCCCAAGTGCAGACCGG - Intergenic
1171908699 20:30921770-30921792 CCGTCCCCCCAAGTGCAGACCGG + Intergenic
1172877406 20:38173762-38173784 CTGTCTTCGCACCTGCAGAGGGG + Intergenic
1174515952 20:51092656-51092678 CTTTCTTCCCAAATGCCAATAGG - Intergenic
1176415537 21:6472522-6472544 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1178916625 21:36708694-36708716 TTGTTTTCCCAAAGGCAGACAGG - Intronic
1179691037 21:43080855-43080877 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1179942230 21:44647724-44647746 CTGTCTTGTTAAAGGCAGACAGG + Intronic
1180312079 22:11249705-11249727 CTGTCCCCCCAAGTGCAGACCGG - Intergenic
1181033774 22:20160340-20160362 CAGTCTTCCCATCTGCCGACGGG + Intergenic
1182390182 22:29987377-29987399 CAGTCTCCTCCAATGCAGACAGG - Intronic
949107381 3:217086-217108 ATTTCTTCCCCAATGCACACAGG - Intronic
949444931 3:4124179-4124201 CTGTCTCCCCAAGTGCAGGGAGG - Intronic
951613600 3:24519541-24519563 CTGTCATCCCTACTGGAGACTGG - Intergenic
953376160 3:42430219-42430241 CTCTCTTCCCGGTTGCAGACCGG - Intergenic
954263213 3:49454979-49455001 CTGCCTTCCTAAATGTAGTCTGG + Intergenic
954994502 3:54869318-54869340 CTGTTTTCCCAAATGCATTATGG + Intronic
955574323 3:60342961-60342983 TTGTCTTCTCACATGAAGACAGG + Intronic
955841255 3:63115255-63115277 TTGTCTTTCCAGATACAGACAGG - Intergenic
956083012 3:65579443-65579465 GTGACTTCCAAAATGCAGCCAGG + Intronic
956393126 3:68795840-68795862 ATGTCTTCCCAAAAGAGGACAGG - Intronic
961074289 3:123967253-123967275 CTGTTTTCCCAAATGTACAAAGG + Intergenic
961309337 3:125984877-125984899 CTGTTTTCCCAAATGTACAAGGG - Intergenic
962305200 3:134280028-134280050 CTGTCTTCCCTCTTCCAGACTGG + Intergenic
963881959 3:150538275-150538297 CTGTGTTGCCAAATACACACAGG - Intergenic
965879188 3:173368138-173368160 TTGTCTTCCAAAATGAAGAAAGG + Intergenic
967270769 3:187730196-187730218 CAGTCTTCCCAATTTCAGGCTGG - Intronic
969865643 4:10075474-10075496 CTTTCTTCCCAGATGCACACCGG - Exonic
970518753 4:16861833-16861855 CTGTCTTCTCAAATAGAAACTGG + Intronic
972302027 4:37793406-37793428 CAGTCTTCCCAAAGGCACAGAGG + Intergenic
972997142 4:44894714-44894736 CTCTCTGCCCATCTGCAGACTGG - Intergenic
973567524 4:52203134-52203156 CTGTCATTCCCAGTGCAGACAGG - Intergenic
975182015 4:71357126-71357148 CTGTCTTCCCAATGTCAGCCAGG - Exonic
975252713 4:72198214-72198236 CTCTATTCCCAGATGCACACAGG - Intergenic
975332681 4:73135760-73135782 CTGTTTTACTAACTGCAGACTGG + Intronic
977662717 4:99609513-99609535 CTGTCCTCCCAAATGCAAAGTGG + Intronic
979161237 4:117464133-117464155 ATTTCATCTCAAATGCAGACAGG + Intergenic
981890834 4:149734676-149734698 CTGTCTTCCCAAAGGCCCAACGG + Intergenic
982076149 4:151739060-151739082 CTTTCTTAGGAAATGCAGACAGG - Intronic
983902527 4:173151360-173151382 CTGTTTTCCTAAAAGTAGACTGG - Intergenic
983932340 4:173466082-173466104 CTGTATCCCCAACTTCAGACTGG - Intergenic
985999787 5:3621277-3621299 CTGTCTTCCTATCTGCAGAGTGG + Intergenic
988834044 5:35014109-35014131 TTGTTTTCCCAGGTGCAGACAGG - Exonic
989280415 5:39635450-39635472 CTGTCCTCGCAAATGCGGGCAGG + Intergenic
990818430 5:59810944-59810966 TTCTTTTCCCAAATGCAGATGGG + Intronic
992356912 5:75995122-75995144 CTGCCCTCACAAATGCAGGCAGG - Intergenic
993347306 5:86800257-86800279 CTGTTTTCACAAATGCAAAGTGG - Intergenic
995294103 5:110498663-110498685 AAGTCTTCCCATATGCAGAATGG + Intronic
997099823 5:130956956-130956978 CTGACTAGCCATATGCAGACTGG - Intergenic
998920093 5:147058664-147058686 CTATCTACCCACATGCAGAATGG + Intronic
999061687 5:148642334-148642356 CAGTTTTCCCAACTGCAGAATGG + Intronic
999852972 5:155562850-155562872 CTGTGTTCTCAGAAGCAGACTGG - Intergenic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1000808214 5:165824471-165824493 CATTCTTCTCAAATGCACACAGG - Intergenic
1003519711 6:6847864-6847886 CTGTCCTCCCAATGGCAGACTGG + Intergenic
1004650384 6:17601775-17601797 CTGTCATCCTAAATTCTGACTGG - Intronic
1005487096 6:26310977-26310999 CTGAGTTCCCAAAGGCAGCCAGG - Intergenic
1010746303 6:79565954-79565976 ATTTCTTTCCAGATGCAGACTGG + Intergenic
1011672194 6:89694125-89694147 CTGTCATCCCAGCTGCAGACTGG - Exonic
1012114927 6:95285079-95285101 GTGTCTTCCCACCTGCAGTCTGG + Intergenic
1014182615 6:118401882-118401904 ATTTCTTTCTAAATGCAGACTGG - Intergenic
1016159279 6:140857545-140857567 CTGTCTTCTCAACTACAGATTGG + Intergenic
1022703894 7:32785609-32785631 ATGTCATTCCAAATGCAGATAGG - Intergenic
1022908140 7:34875738-34875760 ATGTCATTCCAAATGCAGATAGG - Intronic
1023644218 7:42292569-42292591 CTCTCTTCCCCAAAACAGACTGG + Intergenic
1024599818 7:50970444-50970466 GTGGGTTCCCAAAGGCAGACTGG - Intergenic
1025607033 7:63046996-63047018 CTAGCTTCCCATATGCAGAATGG - Intergenic
1026105439 7:67417239-67417261 CTCTCTTCCCAGTTGCAGATAGG - Intergenic
1026485220 7:70812379-70812401 CTGTATTCCCAATTGAAGCCAGG - Intergenic
1026807301 7:73436309-73436331 CTGTGCTTCCAAATGGAGACAGG + Intergenic
1031512252 7:122665181-122665203 CTGCTTGCCCACATGCAGACAGG - Intronic
1031775370 7:125902337-125902359 CAGTCTTCCCAGGTGAAGACTGG - Intergenic
1033760325 7:144430293-144430315 CTGTTTTTCCAAATGCATTCGGG + Intergenic
1034925195 7:155115566-155115588 CTGTCTTCCCACTTGTAGAATGG + Intergenic
1039518623 8:38153086-38153108 CTGTCTCCCCAACACCAGACAGG + Intergenic
1044157576 8:88867355-88867377 CAGTCTTCTCAAATGCACATAGG - Intergenic
1044506616 8:93027504-93027526 CTGTCTTCCCCAACTCAGAATGG + Intergenic
1045628462 8:104085905-104085927 CTGTATTTCCAGATGCTGACAGG - Intronic
1047800190 8:128301229-128301251 CTGTCTTGCCAACTACAGTCTGG - Intergenic
1050505821 9:6348171-6348193 CATTCTTCCCAAATGCACATGGG + Intergenic
1053303757 9:36969608-36969630 CAGTCTCCCCAGAAGCAGACTGG + Intronic
1055145193 9:72925288-72925310 ATCTCTGCCCAAATGCAGACAGG - Intronic
1055594181 9:77848762-77848784 CTGGCTTCCCTAAGGCAGTCTGG + Intronic
1055917489 9:81420650-81420672 CTCTCATCCCAAGTGCAGAAAGG + Intergenic
1056009396 9:82311265-82311287 CTCTCTTGCCTGATGCAGACAGG + Intergenic
1056457970 9:86781620-86781642 CTGTGGGCCCAAATGCAGATGGG - Intergenic
1059405362 9:114095739-114095761 CAGTCTTCCCAACTGCACAAGGG + Intronic
1060116474 9:120945253-120945275 CTGCCTTCCTATATGCAGCCTGG - Intergenic
1060372306 9:123086018-123086040 CTGTCTTCCCACCAGGAGACAGG - Intronic
1060653583 9:125352174-125352196 CTGTCTTCCAGAATTCAGAATGG - Intronic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1189556310 X:42148862-42148884 CAGTCTCCTCAAATGCAGAGTGG - Intergenic
1190477162 X:50839858-50839880 CTGTCTTCCCAAAGACACATGGG - Intergenic
1192896595 X:75448907-75448929 CTGTCCTCCCCAATGCAGGTGGG + Intronic
1198426812 X:136528935-136528957 CTGTCTTCCCTGATGAAGTCAGG + Intergenic
1199713898 X:150492206-150492228 CCATCTTCCAAAATGCAGTCTGG + Intronic