ID: 1134057794

View in Genome Browser
Species Human (GRCh38)
Location 16:11181266-11181288
Sequence GGGGCCCAGCGTGTCCTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057794_1134057806 22 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057806 16:11181311-11181333 GAGTGTGGGAAGGCCCACAGTGG 0: 1
1: 0
2: 2
3: 30
4: 255
1134057794_1134057803 8 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057803 16:11181297-11181319 AGAGGAAGAGCCAGGAGTGTGGG 0: 1
1: 0
2: 5
3: 70
4: 672
1134057794_1134057804 12 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057794_1134057809 25 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057794_1134057796 -10 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057796 16:11181279-11181301 GCTGGGCCCCTGGCATCCAGAGG 0: 1
1: 0
2: 4
3: 39
4: 361
1134057794_1134057800 0 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057800 16:11181289-11181311 TGGCATCCAGAGGAAGAGCCAGG 0: 1
1: 0
2: 2
3: 34
4: 331
1134057794_1134057808 24 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057808 16:11181313-11181335 GTGTGGGAAGGCCCACAGTGGGG 0: 1
1: 0
2: 1
3: 37
4: 230
1134057794_1134057802 7 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057802 16:11181296-11181318 CAGAGGAAGAGCCAGGAGTGTGG 0: 1
1: 1
2: 8
3: 90
4: 864
1134057794_1134057807 23 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057807 16:11181312-11181334 AGTGTGGGAAGGCCCACAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134057794 Original CRISPR GGGGCCCAGCGTGTCCTGTC TGG (reversed) Exonic