ID: 1134057799

View in Genome Browser
Species Human (GRCh38)
Location 16:11181287-11181309
Sequence TGGCTCTTCCTCTGGATGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057799_1134057813 25 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057799_1134057809 4 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057799_1134057804 -9 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057799_1134057808 3 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057808 16:11181313-11181335 GTGTGGGAAGGCCCACAGTGGGG 0: 1
1: 0
2: 1
3: 37
4: 230
1134057799_1134057806 1 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057806 16:11181311-11181333 GAGTGTGGGAAGGCCCACAGTGG 0: 1
1: 0
2: 2
3: 30
4: 255
1134057799_1134057810 10 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057810 16:11181320-11181342 AAGGCCCACAGTGGGGGCTGTGG 0: 1
1: 1
2: 2
3: 57
4: 464
1134057799_1134057807 2 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057807 16:11181312-11181334 AGTGTGGGAAGGCCCACAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134057799 Original CRISPR TGGCTCTTCCTCTGGATGCC AGG (reversed) Exonic