ID: 1134057801

View in Genome Browser
Species Human (GRCh38)
Location 16:11181295-11181317
Sequence CACACTCCTGGCTCTTCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057801_1134057808 -5 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057808 16:11181313-11181335 GTGTGGGAAGGCCCACAGTGGGG 0: 1
1: 0
2: 1
3: 37
4: 230
1134057801_1134057810 2 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057810 16:11181320-11181342 AAGGCCCACAGTGGGGGCTGTGG 0: 1
1: 1
2: 2
3: 57
4: 464
1134057801_1134057807 -6 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057807 16:11181312-11181334 AGTGTGGGAAGGCCCACAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 213
1134057801_1134057813 17 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057801_1134057806 -7 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057806 16:11181311-11181333 GAGTGTGGGAAGGCCCACAGTGG 0: 1
1: 0
2: 2
3: 30
4: 255
1134057801_1134057809 -4 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134057801 Original CRISPR CACACTCCTGGCTCTTCCTC TGG (reversed) Exonic