ID: 1134057804

View in Genome Browser
Species Human (GRCh38)
Location 16:11181301-11181323
Sequence GAAGAGCCAGGAGTGTGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 606}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057789_1134057804 26 Left 1134057789 16:11181252-11181274 CCAGACAGGCCAGTCCAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057798_1134057804 -8 Left 1134057798 16:11181286-11181308 CCCTGGCATCCAGAGGAAGAGCC 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057791_1134057804 17 Left 1134057791 16:11181261-11181283 CCAGTCCAGACAGGACACGCTGG 0: 1
1: 0
2: 2
3: 12
4: 109
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057794_1134057804 12 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057799_1134057804 -9 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057788_1134057804 27 Left 1134057788 16:11181251-11181273 CCCAGACAGGCCAGTCCAGACAG 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606
1134057797_1134057804 -7 Left 1134057797 16:11181285-11181307 CCCCTGGCATCCAGAGGAAGAGC 0: 1
1: 0
2: 1
3: 22
4: 214
Right 1134057804 16:11181301-11181323 GAAGAGCCAGGAGTGTGGGAAGG 0: 1
1: 0
2: 3
3: 51
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134057804 Original CRISPR GAAGAGCCAGGAGTGTGGGA AGG Exonic