ID: 1134057805

View in Genome Browser
Species Human (GRCh38)
Location 16:11181307-11181329
Sequence TGTGGGCCTTCCCACACTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057805_1134057815 27 Left 1134057805 16:11181307-11181329 CCAGGAGTGTGGGAAGGCCCACA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1134057815 16:11181357-11181379 GTCATAGCCTCAGAGGTCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 179
1134057805_1134057814 20 Left 1134057805 16:11181307-11181329 CCAGGAGTGTGGGAAGGCCCACA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1134057814 16:11181350-11181372 CACTCAGGTCATAGCCTCAGAGG 0: 1
1: 0
2: 0
3: 20
4: 260
1134057805_1134057813 5 Left 1134057805 16:11181307-11181329 CCAGGAGTGTGGGAAGGCCCACA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057805_1134057810 -10 Left 1134057805 16:11181307-11181329 CCAGGAGTGTGGGAAGGCCCACA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1134057810 16:11181320-11181342 AAGGCCCACAGTGGGGGCTGTGG 0: 1
1: 1
2: 2
3: 57
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134057805 Original CRISPR TGTGGGCCTTCCCACACTCC TGG (reversed) Exonic