ID: 1134057809

View in Genome Browser
Species Human (GRCh38)
Location 16:11181314-11181336
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057798_1134057809 5 Left 1134057798 16:11181286-11181308 CCCTGGCATCCAGAGGAAGAGCC 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057791_1134057809 30 Left 1134057791 16:11181261-11181283 CCAGTCCAGACAGGACACGCTGG 0: 1
1: 0
2: 2
3: 12
4: 109
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057794_1134057809 25 Left 1134057794 16:11181266-11181288 CCAGACAGGACACGCTGGGCCCC 0: 1
1: 0
2: 3
3: 22
4: 135
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057801_1134057809 -4 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057797_1134057809 6 Left 1134057797 16:11181285-11181307 CCCCTGGCATCCAGAGGAAGAGC 0: 1
1: 0
2: 1
3: 22
4: 214
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276
1134057799_1134057809 4 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057809 16:11181314-11181336 TGTGGGAAGGCCCACAGTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type