ID: 1134057813

View in Genome Browser
Species Human (GRCh38)
Location 16:11181335-11181357
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134057801_1134057813 17 Left 1134057801 16:11181295-11181317 CCAGAGGAAGAGCCAGGAGTGTG 0: 1
1: 0
2: 3
3: 29
4: 401
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057805_1134057813 5 Left 1134057805 16:11181307-11181329 CCAGGAGTGTGGGAAGGCCCACA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057799_1134057813 25 Left 1134057799 16:11181287-11181309 CCTGGCATCCAGAGGAAGAGCCA 0: 1
1: 0
2: 5
3: 33
4: 225
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057798_1134057813 26 Left 1134057798 16:11181286-11181308 CCCTGGCATCCAGAGGAAGAGCC 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212
1134057797_1134057813 27 Left 1134057797 16:11181285-11181307 CCCCTGGCATCCAGAGGAAGAGC 0: 1
1: 0
2: 1
3: 22
4: 214
Right 1134057813 16:11181335-11181357 GGCTGTGGCTTCTGACACTCAGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type