ID: 1134058072

View in Genome Browser
Species Human (GRCh38)
Location 16:11182593-11182615
Sequence CAGGCTGGGCCGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134058065_1134058072 15 Left 1134058065 16:11182555-11182577 CCTCGCAGGACAAGCGTAGCGAG No data
Right 1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG No data
1134058063_1134058072 20 Left 1134058063 16:11182550-11182572 CCCTACCTCGCAGGACAAGCGTA No data
Right 1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG No data
1134058062_1134058072 25 Left 1134058062 16:11182545-11182567 CCAAGCCCTACCTCGCAGGACAA No data
Right 1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG No data
1134058064_1134058072 19 Left 1134058064 16:11182551-11182573 CCTACCTCGCAGGACAAGCGTAG No data
Right 1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134058072 Original CRISPR CAGGCTGGGCCGAGGGAAGC AGG Intergenic
No off target data available for this crispr