ID: 1134058245

View in Genome Browser
Species Human (GRCh38)
Location 16:11183332-11183354
Sequence CAGTAGGACGTGGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134058245_1134058256 1 Left 1134058245 16:11183332-11183354 CCCCCTTCCCCCACGTCCTACTG No data
Right 1134058256 16:11183356-11183378 TCTGTGGCACTTCATGGCGTTGG No data
1134058245_1134058255 -5 Left 1134058245 16:11183332-11183354 CCCCCTTCCCCCACGTCCTACTG No data
Right 1134058255 16:11183350-11183372 TACTGCTCTGTGGCACTTCATGG No data
1134058245_1134058257 2 Left 1134058245 16:11183332-11183354 CCCCCTTCCCCCACGTCCTACTG No data
Right 1134058257 16:11183357-11183379 CTGTGGCACTTCATGGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134058245 Original CRISPR CAGTAGGACGTGGGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr