ID: 1134065292

View in Genome Browser
Species Human (GRCh38)
Location 16:11224490-11224512
Sequence CCCGGGAGAGGGGGGTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134065276_1134065292 4 Left 1134065276 16:11224463-11224485 CCGCACAGCTGCCACCGCCGGCC 0: 1
1: 0
2: 2
3: 21
4: 341
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1134065272_1134065292 24 Left 1134065272 16:11224443-11224465 CCTCTCTAGCTGCCCACACGCCG 0: 1
1: 0
2: 1
3: 5
4: 115
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1134065273_1134065292 12 Left 1134065273 16:11224455-11224477 CCCACACGCCGCACAGCTGCCAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1134065280_1134065292 -7 Left 1134065280 16:11224474-11224496 CCACCGCCGGCCCTGGCCCGGGA 0: 1
1: 0
2: 5
3: 60
4: 823
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1134065274_1134065292 11 Left 1134065274 16:11224456-11224478 CCACACGCCGCACAGCTGCCACC 0: 1
1: 0
2: 2
3: 31
4: 282
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1134065281_1134065292 -10 Left 1134065281 16:11224477-11224499 CCGCCGGCCCTGGCCCGGGAGAG 0: 1
1: 0
2: 4
3: 64
4: 449
Right 1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134065292 Original CRISPR CCCGGGAGAGGGGGGTCTCT GGG Intergenic