ID: 1134065549

View in Genome Browser
Species Human (GRCh38)
Location 16:11225847-11225869
Sequence GCTGCTCATGCCCACCTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134065544_1134065549 4 Left 1134065544 16:11225820-11225842 CCTCACATCCTCATCTGAAGAGG No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065539_1134065549 23 Left 1134065539 16:11225801-11225823 CCCGCCTCTTCCCTCTGAGCCTC No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065542_1134065549 13 Left 1134065542 16:11225811-11225833 CCCTCTGAGCCTCACATCCTCAT No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065538_1134065549 28 Left 1134065538 16:11225796-11225818 CCGGGCCCGCCTCTTCCCTCTGA No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065540_1134065549 22 Left 1134065540 16:11225802-11225824 CCGCCTCTTCCCTCTGAGCCTCA No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065543_1134065549 12 Left 1134065543 16:11225812-11225834 CCTCTGAGCCTCACATCCTCATC No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065547_1134065549 -4 Left 1134065547 16:11225828-11225850 CCTCATCTGAAGAGGGAATGCTG No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data
1134065541_1134065549 19 Left 1134065541 16:11225805-11225827 CCTCTTCCCTCTGAGCCTCACAT No data
Right 1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134065549 Original CRISPR GCTGCTCATGCCCACCTTGC GGG Intergenic
No off target data available for this crispr