ID: 1134066445

View in Genome Browser
Species Human (GRCh38)
Location 16:11231578-11231600
Sequence GGGTCAGTCCTGAAACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134066445_1134066453 24 Left 1134066445 16:11231578-11231600 CCTCCTTGTTTCAGGACTGACCC No data
Right 1134066453 16:11231625-11231647 AAACTCTAAGCCTCCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134066445 Original CRISPR GGGTCAGTCCTGAAACAAGG AGG (reversed) Intergenic
No off target data available for this crispr