ID: 1134068547

View in Genome Browser
Species Human (GRCh38)
Location 16:11246147-11246169
Sequence AACTATCTCAGGTCTAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134068547_1134068550 -2 Left 1134068547 16:11246147-11246169 CCCAGGCTAGACCTGAGATAGTT No data
Right 1134068550 16:11246168-11246190 TTTCACTTTGACCCAACTTCTGG No data
1134068547_1134068551 7 Left 1134068547 16:11246147-11246169 CCCAGGCTAGACCTGAGATAGTT No data
Right 1134068551 16:11246177-11246199 GACCCAACTTCTGGCAACTGTGG No data
1134068547_1134068554 24 Left 1134068547 16:11246147-11246169 CCCAGGCTAGACCTGAGATAGTT No data
Right 1134068554 16:11246194-11246216 CTGTGGCCTTTCCTGTCAGAAGG No data
1134068547_1134068555 28 Left 1134068547 16:11246147-11246169 CCCAGGCTAGACCTGAGATAGTT No data
Right 1134068555 16:11246198-11246220 GGCCTTTCCTGTCAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134068547 Original CRISPR AACTATCTCAGGTCTAGCCT GGG (reversed) Intergenic