ID: 1134070535

View in Genome Browser
Species Human (GRCh38)
Location 16:11256943-11256965
Sequence TGCGGAAGAAACTGAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 599}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134070522_1134070535 3 Left 1134070522 16:11256917-11256939 CCCTCCCTGCGCTCCCACTACCC 0: 1
1: 0
2: 2
3: 59
4: 619
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070525_1134070535 -1 Left 1134070525 16:11256921-11256943 CCCTGCGCTCCCACTACCCGGCT 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070520_1134070535 20 Left 1134070520 16:11256900-11256922 CCTGGTGGCCTCGACTGCCCTCC 0: 1
1: 0
2: 1
3: 44
4: 372
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070526_1134070535 -2 Left 1134070526 16:11256922-11256944 CCTGCGCTCCCACTACCCGGCTG 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070521_1134070535 12 Left 1134070521 16:11256908-11256930 CCTCGACTGCCCTCCCTGCGCTC 0: 1
1: 0
2: 0
3: 25
4: 291
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070523_1134070535 2 Left 1134070523 16:11256918-11256940 CCTCCCTGCGCTCCCACTACCCG 0: 1
1: 0
2: 0
3: 13
4: 255
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070528_1134070535 -10 Left 1134070528 16:11256930-11256952 CCCACTACCCGGCTGCGGAAGAA 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599
1134070519_1134070535 21 Left 1134070519 16:11256899-11256921 CCCTGGTGGCCTCGACTGCCCTC 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 70
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134070535 Original CRISPR TGCGGAAGAAACTGAGGCTG GGG Intronic
900366767 1:2314808-2314830 CGGGGGGGAAACTGAGGCTGCGG - Intergenic
900730701 1:4257408-4257430 TGCAGAAGAACTTGAGGCTCTGG + Intergenic
901174226 1:7286831-7286853 AGAGGAGGAAACTGAGGCTTAGG - Intronic
901219553 1:7575588-7575610 TGGGGCAGAAACTGAGGCCCTGG - Intronic
901303033 1:8213361-8213383 AGATGAAGAAACTGAGGCTCAGG + Intergenic
901685810 1:10942727-10942749 AGAGCAAGAAACTGAGGCTCAGG - Intergenic
901806239 1:11740348-11740370 AGATGAAGAAACTGAGGCAGGGG + Intronic
902376382 1:16031983-16032005 TGATGAGGAAACTGAGGCTCAGG - Intronic
902381349 1:16053912-16053934 TGATGAGGAAACTGAGGCTCAGG - Intronic
902554772 1:17240463-17240485 TCCGGGGGAAACTGAGGCTCAGG - Intronic
902638644 1:17751622-17751644 AGATGAAGAAACTGAGGCTTGGG + Intergenic
902664905 1:17930625-17930647 AGTGGAGGAAACTGAGGCTCAGG - Intergenic
902799423 1:18820038-18820060 AGAGGAGGAAACTGAGGCTGGGG - Intergenic
903171918 1:21559460-21559482 AGGGGAAGAGACTGAGGCTGAGG + Intronic
903260503 1:22129289-22129311 TAAGGAAGAAACTGAGGCTCAGG - Intronic
903276131 1:22223113-22223135 AGGAGAAGAAACTGAGGCTCAGG - Intergenic
903445953 1:23423399-23423421 AGATGAAGAAACTGAGGCTCTGG + Intronic
903453302 1:23469768-23469790 AGATGAAGAAACTGAGGCTGGGG + Intronic
903457794 1:23500053-23500075 TGAGGCAGTAGCTGAGGCTGAGG + Intergenic
903470083 1:23580740-23580762 AAAGGAAGAAACTGAGGCTCAGG - Intergenic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
903811966 1:26039582-26039604 CCATGAAGAAACTGAGGCTGGGG - Intronic
903956506 1:27029713-27029735 AGGTGAAGAAACTGAGGCTCAGG + Intergenic
904266457 1:29320961-29320983 AGATGAAGAAACTGAGGCTCTGG - Intronic
904274101 1:29369264-29369286 AGAAGAAGAAACTGAGGCTCAGG + Intergenic
904364380 1:30001233-30001255 TTGAGAAGAAACTGAGGCTCAGG + Intergenic
904828005 1:33288155-33288177 AGAGGGGGAAACTGAGGCTGAGG + Intronic
904915976 1:33970921-33970943 TGATGAGGAAACTGAGGCAGAGG - Intronic
905344691 1:37303304-37303326 AGAGGAAGAAACTGAGGCTCAGG + Intergenic
905562804 1:38940911-38940933 AGCTGAGGAAACTGAGGCTCAGG + Intronic
905627136 1:39496493-39496515 AGAGGAGGAAACTGAGGCTTGGG - Intronic
905669799 1:39784278-39784300 AGAGGAGGAAACTGAGGCTTGGG + Intronic
905842312 1:41192413-41192435 TGCGGAGGAAACTCAGGCACAGG - Intronic
905883894 1:41481453-41481475 TGCAGGGGAAACTGAGGCAGGGG + Intronic
906475023 1:46163800-46163822 AGCTGAGGAAACTGAGGCTCAGG - Intronic
906745914 1:48222129-48222151 AGTGTAGGAAACTGAGGCTGGGG - Intergenic
906783737 1:48595965-48595987 TGGGGAAGAAACTGAAGCTTAGG + Intronic
907297497 1:53464721-53464743 GGCGGGAGGAACTGGGGCTGCGG - Exonic
907518457 1:55008087-55008109 TTGGGAAGAAACTGAGGCCCGGG + Intronic
908084005 1:60611027-60611049 TGCTGCTGAAACTGATGCTGAGG - Intergenic
908253248 1:62281891-62281913 AGATGAGGAAACTGAGGCTGAGG + Intronic
908312475 1:62898997-62899019 AGAGGAAGAAACTGAGGCACAGG - Intergenic
908685689 1:66716857-66716879 TGTGGAAGCAAATGAGGCTTGGG - Intronic
909758947 1:79265533-79265555 TGCAGAAGAAACTGACACTCAGG + Intergenic
910859785 1:91732188-91732210 TGCTGTGGAAACTGAGGCTCTGG + Intronic
912177753 1:107181546-107181568 TGAGGAAAAAACTGTGGCTGAGG + Intronic
912710077 1:111943815-111943837 AGAGGAAGAAACTGATGCTGAGG + Intronic
913185876 1:116370668-116370690 TGATGAAGAAACTGAGGCCCAGG - Intergenic
913497442 1:119441355-119441377 TGGTGAGGAAACTGAGGCTCAGG - Intergenic
914262026 1:146007192-146007214 AGCATAAGAAACTGAGGTTGAGG - Intergenic
916079975 1:161226371-161226393 TGTGGAAGTTTCTGAGGCTGGGG + Exonic
916176926 1:162049640-162049662 AGCTGAGGAAATTGAGGCTGAGG + Intergenic
916177899 1:162057835-162057857 AGAAGAGGAAACTGAGGCTGGGG - Intergenic
916721023 1:167484867-167484889 AGCTGAGGAGACTGAGGCTGAGG + Intronic
917798344 1:178548252-178548274 TGCAGAGGAACATGAGGCTGGGG - Intronic
918141162 1:181721104-181721126 TGCAGGAGACACTGAGTCTGAGG + Intronic
918345601 1:183604635-183604657 TGAGGAAGACACAGAGGCAGAGG - Intergenic
919132839 1:193472937-193472959 TACAGACGAAACTGAGGCTATGG + Intergenic
919639891 1:200037203-200037225 TGAGGCTGAACCTGAGGCTGAGG - Intronic
919681683 1:200441799-200441821 TGAGGTAGAAGCTGAGCCTGAGG + Intergenic
920043394 1:203118092-203118114 AGAGGAGGAAACTGAGGCTGGGG - Intronic
922066026 1:222144391-222144413 GGCTGAGGAAACTGAGGCTTAGG - Intergenic
922228381 1:223665319-223665341 TGAGGGAGAAGTTGAGGCTGTGG - Intronic
922674803 1:227543588-227543610 AGTGGAGGAAACTGAGGCAGAGG + Intergenic
923260885 1:232267009-232267031 AGCTGAGGAAACTGAGGCTCAGG + Intergenic
923612724 1:235509764-235509786 AGCAGAAGAATCTGGGGCTGTGG - Intergenic
924029617 1:239873245-239873267 AGCTGAGGAAACTGAGGCTCAGG - Intronic
924029728 1:239874071-239874093 AGCTGAGGAAACTGAGGCTCAGG + Intronic
924090317 1:240494258-240494280 AGTGAAGGAAACTGAGGCTGGGG + Intronic
924448686 1:244158197-244158219 TGCTGAATAAAATAAGGCTGAGG - Intergenic
1063160296 10:3413691-3413713 TAAGGAAGAAACAGAGGCTGGGG + Intergenic
1063674672 10:8130095-8130117 GAAGGAAGAAACTGAGGCTTTGG - Intergenic
1064767947 10:18694066-18694088 TGCTGAGGAATCTGGGGCTGAGG + Intergenic
1066525740 10:36277221-36277243 AGAGGAGGAAACAGAGGCTGAGG + Intergenic
1066616499 10:37300320-37300342 TGCAGAAGCAGCTGAGGCTCTGG + Intronic
1067340275 10:45395682-45395704 TGATGAAGAAACTGAGGCTTAGG - Intronic
1069595758 10:69669037-69669059 TAGGGAGGAAACTGAGGCTGGGG + Intergenic
1069753509 10:70760028-70760050 TGCATCAGAAACTCAGGCTGGGG - Intronic
1070341265 10:75500389-75500411 TACAGAAGAAACTGAGGCTGAGG + Intronic
1070553582 10:77511152-77511174 TGAATCAGAAACTGAGGCTGGGG - Intronic
1070742211 10:78910641-78910663 AGAGGAGGAAACTGAGGCTCAGG - Intergenic
1072627580 10:97123107-97123129 AGATGAAGAAACTGAGGCTTAGG + Intronic
1072681642 10:97511898-97511920 AGATGAGGAAACTGAGGCTGTGG + Intronic
1072916439 10:99540048-99540070 AGAGGAAGAAACTGAGGTTCAGG - Intergenic
1072921769 10:99582909-99582931 TCAGGAGGAAACTGAGGCTCTGG + Intergenic
1073288899 10:102403710-102403732 AGAGGAGGAAACTGAGGCTTAGG + Intronic
1073328538 10:102656550-102656572 AGCTGAAGAAATGGAGGCTGGGG - Intronic
1073489540 10:103843850-103843872 AGGGGAGGAAACTGAGGCTCAGG - Intronic
1073609726 10:104931151-104931173 TGATGAAGAAACTGAGTCTCAGG + Intronic
1073638192 10:105220729-105220751 TGGGGAAGAGAAAGAGGCTGTGG - Intronic
1074186443 10:111102907-111102929 AGAGGAGGAAGCTGAGGCTGGGG + Intergenic
1074665946 10:115724366-115724388 TGCTGAAGAAAATGGGCCTGTGG + Intronic
1074903558 10:117840341-117840363 TGCTGAAGATGCTGAGGCTGTGG - Intergenic
1075055514 10:119215512-119215534 TGAGGAAGAGACTGAGGAAGGGG + Intronic
1075537034 10:123279872-123279894 AGAGGAAGAAACTGAGGCACAGG - Intergenic
1075622698 10:123939510-123939532 GGATGAAGAAACTGAGGCTGAGG - Intronic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1076717630 10:132374460-132374482 GGCAGAACAAAGTGAGGCTGAGG - Intronic
1077637079 11:3850315-3850337 AGATGAAGAAACTGAGGCTCAGG - Intergenic
1077774015 11:5251656-5251678 TGTGGAAAACTCTGAGGCTGAGG + Intronic
1077881455 11:6353874-6353896 TCCTGATGAAACTGAGGGTGGGG - Intergenic
1078452135 11:11448554-11448576 TAATGGAGAAACTGAGGCTGAGG + Intronic
1078665469 11:13321414-13321436 GGATGAAGAAACTGAGGCTTAGG + Intronic
1079159688 11:17980223-17980245 AGATGAAGAAACTGAGGCTCAGG + Intronic
1079242834 11:18732865-18732887 AGAGGAAGAAACTGAGACTCAGG - Intronic
1080342971 11:31289805-31289827 AGATGAAGAAACTGAGGCTCAGG + Intronic
1080388689 11:31825335-31825357 TGCAAGAGAATCTGAGGCTGGGG + Intronic
1080822933 11:35824400-35824422 AGATGAAGAAACTGAGGCCGAGG + Intergenic
1081461808 11:43279160-43279182 AGAGGAAGAAACTGAGGCTTAGG + Intergenic
1081830278 11:46105101-46105123 AGGTGAAGAAACTGAGGCAGAGG + Intronic
1082203719 11:49405475-49405497 TGGTGAAGAAACTGAGGCTTTGG - Intergenic
1082772490 11:57219247-57219269 TGCAGAAGTAACTGAAGCTCAGG - Intergenic
1083659984 11:64247439-64247461 AGCGGAAGAAGCCGGGGCTGGGG + Intergenic
1083963372 11:66026879-66026901 AGAGGAAGAAACTGAGGCACGGG - Intergenic
1084030820 11:66479780-66479802 TGCTAAGGAAACTGAGGCTCGGG + Intergenic
1084173364 11:67410965-67410987 TCCGGGGGAAACTGAGGCTCAGG + Intronic
1084299530 11:68238072-68238094 TGAGGAAAATGCTGAGGCTGGGG + Intergenic
1084311179 11:68317217-68317239 AGATGAGGAAACTGAGGCTGAGG - Intronic
1084333745 11:68445386-68445408 AGTTGAAGAAACTGAGGCTGAGG + Intronic
1084400541 11:68940431-68940453 TGCTGAAGATGCTGAGGCTGTGG - Exonic
1085019187 11:73194432-73194454 TAAAGAAGAAACTGAGGCTTGGG + Intergenic
1085218367 11:74851757-74851779 AGTGGTAGAAACTGAGGCTCAGG - Intronic
1085389555 11:76175567-76175589 TGGGGTGGAAAATGAGGCTGGGG - Intergenic
1085395695 11:76206167-76206189 AGAGGAGGAAACAGAGGCTGAGG + Intronic
1085743302 11:79094830-79094852 TGCGGAAGATTCAAAGGCTGGGG + Intronic
1086651368 11:89294960-89294982 TGATGAAGAAACTGAGGCTTTGG + Intronic
1087077660 11:94140372-94140394 TGGGGAAGAAACTGAGATTGAGG - Intronic
1087926694 11:103926973-103926995 TGTGGAGGAAATTGTGGCTGTGG - Exonic
1088227282 11:107635141-107635163 TGTGGAAGAGAATGAGGATGAGG - Intronic
1089026656 11:115277941-115277963 GATGGAAGAAACTGAGGATGAGG - Intronic
1090204985 11:124879151-124879173 TGTGGAGGGAACAGAGGCTGCGG + Intronic
1090426437 11:126609989-126610011 AGATGAAGAAACTGAGGCTCAGG + Intronic
1091092202 11:132782034-132782056 TGCAGATGAAACTGAAGATGTGG - Intronic
1091306722 11:134541102-134541124 AGATGAAGAAACTGAGGTTGAGG + Intergenic
1091642605 12:2248857-2248879 AGAGGGAGAAACAGAGGCTGAGG - Intronic
1091816970 12:3446076-3446098 TGCCCAAGGAACTGAGGGTGGGG - Intronic
1093503260 12:19836286-19836308 GGCGGAAGATGCGGAGGCTGGGG + Intergenic
1094279786 12:28723478-28723500 TGGAGAAGAAACTGATGCTGAGG + Intergenic
1094800824 12:34033101-34033123 TGCTGAAGAAACTGAAGGTCAGG + Intergenic
1095220838 12:39612788-39612810 TGCAGCAGAAACTGAAGCTATGG + Intronic
1095597961 12:43980456-43980478 AGCCTATGAAACTGAGGCTGTGG + Intronic
1095943753 12:47741855-47741877 CAGGGAAGAAAGTGAGGCTGAGG - Intronic
1095976755 12:47945461-47945483 TGATGAGGAAACTGAGGCTCAGG - Intergenic
1096082005 12:48839843-48839865 TGAGGAAGAAGCTGAGGCTAAGG - Exonic
1096235011 12:49920637-49920659 TGAGGAAGAAACTGAAGCACAGG + Intergenic
1096493318 12:52024853-52024875 AAAGGAGGAAACTGAGGCTGAGG - Intronic
1096693119 12:53333165-53333187 AGAGAAGGAAACTGAGGCTGTGG - Intronic
1096910026 12:54974133-54974155 TCTGTAAGAACCTGAGGCTGGGG - Intronic
1098309686 12:69135963-69135985 TGTGGAAGAAACTGAAGTTATGG - Intergenic
1098893210 12:76030759-76030781 TGCGGCTGAGGCTGAGGCTGGGG + Exonic
1099957888 12:89368901-89368923 TGCGGAAGAAGCTGGGGCTTTGG - Intergenic
1101005704 12:100399095-100399117 AGTTGAGGAAACTGAGGCTGAGG + Intronic
1101199410 12:102419165-102419187 TACTGATGAAACTGAGGCTTGGG + Intronic
1101252291 12:102948310-102948332 TGAGGAAGAATCAGAGGATGAGG + Intronic
1101650152 12:106669982-106670004 AGATGAGGAAACTGAGGCTGAGG - Intronic
1101855492 12:108439477-108439499 AGCAGAGGAAACTGAGGCTTAGG - Intergenic
1101913791 12:108880410-108880432 AGGTGAAGAAACTGAGGCTTGGG - Intronic
1101965172 12:109277448-109277470 AGATGAAGAAACTGAGGCTCAGG - Intergenic
1102043643 12:109816371-109816393 AGAGGAGGAAACTGAGGCTTGGG - Intronic
1102355877 12:112235150-112235172 TGGAGAAGAGAGTGAGGCTGTGG - Exonic
1102413344 12:112739357-112739379 AGTGGAGGAAACTGAGGCTTAGG + Intronic
1102484153 12:113244805-113244827 GGATGAAGAAACTGAGGCTCTGG + Intronic
1102960515 12:117090577-117090599 AGATGAAGAAACTGAGGCTCAGG + Intronic
1103174098 12:118846884-118846906 AGCTGAGGAAACTGAGGCTTAGG + Intergenic
1104850144 12:131868786-131868808 TGCACAAGAAAGGGAGGCTGGGG - Intergenic
1104989540 12:132618032-132618054 TGGGGACGAAACAGAGGCGGTGG + Intergenic
1106024956 13:25947670-25947692 TGTGGAAGCAGCTGAGGCTCTGG + Intronic
1106225872 13:27786600-27786622 AGATGAAGAAACTGAGGCTCGGG - Intergenic
1106526093 13:30542463-30542485 AGAGGAAGAAACCGAGGATGAGG - Intronic
1106593676 13:31119430-31119452 AGATGAAGAAACTGAGGCTTAGG + Intergenic
1107665444 13:42684306-42684328 TCAGCTAGAAACTGAGGCTGCGG - Intergenic
1108259240 13:48640544-48640566 CAAGGAAGAAACTGATGCTGTGG + Intergenic
1108338715 13:49474387-49474409 TGCTGAAGAAACTGACACTATGG + Intronic
1108496421 13:51029923-51029945 AGAGGAAGAAACTGAGGCTCAGG + Intergenic
1108938700 13:55920780-55920802 GGAGGAAGAAACTGAAGATGTGG + Intergenic
1108985356 13:56579915-56579937 TCCTTAAGAAACTGAGGCAGTGG - Intergenic
1110523298 13:76505957-76505979 TGCGGGAGAAACAGAAGATGAGG + Intergenic
1111424072 13:88056544-88056566 ACCGTAAGAAACTTAGGCTGTGG + Intergenic
1113072589 13:106435814-106435836 AGATGAAGAAACTGAGGCTTAGG + Intergenic
1113850332 13:113414109-113414131 AGAGGAGGAAACTGCGGCTGAGG - Intergenic
1114650195 14:24279895-24279917 TGTGGAACAAAGTGAGACTGTGG + Intergenic
1115306874 14:31942907-31942929 AGATGAAGAAACTGAGGCTCAGG - Intergenic
1115994432 14:39181135-39181157 TGGGGCTGAGACTGAGGCTGAGG - Exonic
1116376770 14:44212176-44212198 TGAGGAAGAAACTGAGATTCTGG - Intergenic
1117767905 14:59101981-59102003 TTAGGATGAAACAGAGGCTGTGG - Intergenic
1118785407 14:69041702-69041724 TGGGGAGGAAAATGAGGGTGGGG - Intergenic
1119193728 14:72702037-72702059 AGATGAAGAAACTGAGTCTGGGG + Intronic
1119196384 14:72719796-72719818 TGATGAAGAAACTGAGGCCCAGG + Intronic
1119390633 14:74289000-74289022 TACGGAAGAGGCTGAGGCAGGGG + Intronic
1119527300 14:75333005-75333027 TGAGGAAGAAAATGAGGAGGAGG + Intergenic
1119638592 14:76296740-76296762 TGATTAAGAAACTGAGGCAGTGG - Intergenic
1121270165 14:92632541-92632563 AGATAAAGAAACTGAGGCTGGGG + Intronic
1121324976 14:93014555-93014577 GGAGGAAGGAACTGAGGCTGTGG + Intronic
1121415264 14:93774894-93774916 AGAGGAAGAAATTGAGGCTTAGG + Intronic
1121578761 14:95010610-95010632 TGCTGAGGAATCTGAGGCTCAGG - Intergenic
1121798899 14:96757094-96757116 TGCTGAGGAAACTTAAGCTGGGG - Intergenic
1122011882 14:98757126-98757148 TGTTGTAGAAACTGAGGCTCAGG + Intergenic
1122031991 14:98919082-98919104 TGTGGATGAAGCTGGGGCTGTGG - Intergenic
1122152872 14:99734209-99734231 TAGGCAAGAAACCGAGGCTGGGG + Intergenic
1122293676 14:100693242-100693264 ACCGGCAGAAAGTGAGGCTGGGG + Intergenic
1122744847 14:103891549-103891571 TGTGGCAGGAGCTGAGGCTGGGG - Intergenic
1122843196 14:104476718-104476740 TGCGGAAGAATCTGTTGCCGTGG + Intronic
1123403880 15:20009413-20009435 GGGGGGAGAAACTGAGGCTCTGG + Intergenic
1123513220 15:21016059-21016081 GGGGGGAGAAACTGAGGCTCTGG + Intergenic
1124103193 15:26714157-26714179 AAGGGAAGAAACTGAGGCTTAGG - Intronic
1126274926 15:46866036-46866058 AGCAAAAGAAACTGAGGCTCAGG - Intergenic
1127310175 15:57745371-57745393 TGCGGAAGGATCTCAGGGTGGGG + Intronic
1127315098 15:57787718-57787740 AGATGAAGAAACTGAGGCTAAGG + Intergenic
1127374513 15:58370797-58370819 TGTAGAAGAAAATGAGTCTGCGG + Intronic
1128216809 15:65940094-65940116 TGGGGCATAAAATGAGGCTGTGG + Intronic
1128247417 15:66142626-66142648 TGCTGATGAGACTGAGTCTGAGG + Intronic
1128378644 15:67094975-67094997 TGCTGGAGAAACTGAGGCTCAGG - Intronic
1128393313 15:67198002-67198024 TGAGAAAGAGTCTGAGGCTGAGG - Intergenic
1128474125 15:67982499-67982521 TGGGGAGGAAACTGAGGTTAGGG + Intergenic
1128579505 15:68798963-68798985 TGCAGAAGAACCTAAGGCTGGGG + Intronic
1128908805 15:71493501-71493523 AGCTGAATAAACTGAGGCTCCGG + Intronic
1129191422 15:73939875-73939897 ACCGGAGGAAACTGAGGCTCAGG - Intronic
1129615544 15:77096677-77096699 TGCGGTTGGCACTGAGGCTGGGG + Intergenic
1129707928 15:77805243-77805265 AGAGGAGGAAACTGAGGCTCAGG - Intronic
1130178962 15:81606175-81606197 TGGGAAAGACAATGAGGCTGGGG - Intergenic
1130570324 15:85036953-85036975 TGGGGAAGAAGCTGGGGGTGGGG - Intronic
1130963270 15:88679084-88679106 AGATGAAGAAACTGAGGCTTAGG - Intergenic
1131113789 15:89781570-89781592 AGTTGAAGAAACTGAGGCTCAGG - Intergenic
1131395715 15:92084430-92084452 AGAGGAGGAAACTGAGGCCGAGG + Intronic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1134513902 16:14871215-14871237 ATAGGAAGAAATTGAGGCTGTGG + Intronic
1134701543 16:16269715-16269737 ATAGGAAGAAATTGAGGCTGTGG + Intronic
1134970287 16:18524936-18524958 ATAGGAAGAAATTGAGGCTGTGG - Intronic
1135107050 16:19658935-19658957 AGCTGGAGAAACTGAGGCTCAGG + Intronic
1135857750 16:26027768-26027790 AGAAGAAGAAACTGAGGCTTAGG + Intronic
1135915929 16:26605432-26605454 AGCTGAAGAAACTGAGGCACAGG - Intergenic
1136004653 16:27320486-27320508 TGAGGAGGAACCTGAGGCTCAGG + Intronic
1136172479 16:28497204-28497226 TGCCAGAGAAACTGAGGATGAGG + Exonic
1136253486 16:29023124-29023146 TGCTGAAGAAACTGAGGCAGAGG - Intergenic
1136275364 16:29176628-29176650 AGAGGAGGAAACTGAGGCTTGGG + Intergenic
1137825897 16:51494519-51494541 AGTTGAAGAAACTGAGGCTTGGG - Intergenic
1138334735 16:56244255-56244277 AGAGGAAGAAACTGAGGCCCAGG - Intronic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1138652543 16:58469183-58469205 TACGGAGGAAACTGAGGCATAGG + Intronic
1138685642 16:58723063-58723085 AGAGGAGGAAACTGAGGCTCAGG - Intronic
1139669275 16:68480901-68480923 TGATGAGGAAACTGAGGCTTTGG - Intergenic
1139824792 16:69748437-69748459 TGCGAAGGAAACTCAGCCTGGGG + Intronic
1140183158 16:72741042-72741064 AGAGGAGGAAACTGAGGCTCAGG - Intergenic
1140480829 16:75262023-75262045 AGAGGAGGAAACTGAGGCTCAGG + Intronic
1141160914 16:81628518-81628540 TGATGTGGAAACTGAGGCTGAGG + Intronic
1141177617 16:81730975-81730997 TCCGGACCAAACTGAGGGTGGGG + Intergenic
1141413341 16:83851492-83851514 TGCTGAAGGAGCTGTGGCTGAGG - Intergenic
1141639607 16:85333587-85333609 AGAGGAAGAAACTGAGGCCCAGG - Intergenic
1141800660 16:86306451-86306473 AGATGAAGAAACTGAGGCTTTGG - Intergenic
1141803557 16:86327344-86327366 AGAAGAAGAAACTGAGGCTCAGG - Intergenic
1141809484 16:86365353-86365375 AGAGGAAGAAACTGAGGCCCAGG - Intergenic
1141987560 16:87589774-87589796 CAGGGAAGAAACTGAGGCTCTGG + Intergenic
1142079724 16:88142693-88142715 AGAGGAGGAAACTGAGGCTTGGG + Intergenic
1142207354 16:88790458-88790480 TGTGGAAGACACAGAGACTGTGG - Intergenic
1142604033 17:1071874-1071896 GCCAGAAGAACCTGAGGCTGGGG - Intronic
1142873228 17:2834826-2834848 TGGGGTAGGAACTGAGGCAGAGG - Intronic
1143592300 17:7892906-7892928 TGTGGCAGCACCTGAGGCTGAGG - Intronic
1144707621 17:17380047-17380069 TACTGGAGAAACTGAGGCTGAGG - Intergenic
1144965820 17:19076716-19076738 TGGGGAGGAGACTGAGGCAGCGG + Intergenic
1144968554 17:19093030-19093052 TGATGAAGAAACTGAGGCCCAGG - Exonic
1144979363 17:19159033-19159055 TGATGAAGAAACTGAGGCCCAGG + Exonic
1144982148 17:19175466-19175488 TGGGGAGGAGACTGAGGCAGCGG - Intergenic
1144986075 17:19202773-19202795 TGGGGAGGAGACTGAGGCAGCGG + Intergenic
1144988859 17:19219199-19219221 TGATGAAGAAACTGAGGCCCAGG - Exonic
1145246518 17:21273266-21273288 TGAGAAAGATTCTGAGGCTGTGG - Intergenic
1145775900 17:27528401-27528423 TTTGGAAGAAACTGAAGCTCAGG + Intronic
1146545730 17:33736464-33736486 GGCGGGAGACACTGAGGCAGGGG - Intronic
1146751935 17:35389705-35389727 TGGGGAAGAAACAGAGCCTGAGG - Intergenic
1146930199 17:36771620-36771642 GGTGGATGAAAATGAGGCTGGGG + Intergenic
1147165414 17:38590652-38590674 AGGTGAAGAAACTGAGGCTCAGG + Intronic
1147757154 17:42776298-42776320 TGGGGAAGACACAGAGGATGAGG + Exonic
1148804349 17:50256922-50256944 TGCAAAAAAAATTGAGGCTGGGG + Intergenic
1148823327 17:50373621-50373643 TAAGGAAGAAACTGAGGCCTAGG + Intronic
1148871022 17:50658898-50658920 TGAGGAAGCACCCGAGGCTGGGG + Intronic
1149351498 17:55792654-55792676 GGAGGAAGAAACTGAGGCCCAGG - Intronic
1149373886 17:56024106-56024128 AGAGGAAGAAACTGAGGCACAGG - Intergenic
1149452390 17:56759878-56759900 TGATGAGGAAACTGAGGCTCAGG - Intergenic
1149810943 17:59670992-59671014 GGTTGAAGAAACTGAGGCTGAGG - Intronic
1149819846 17:59765672-59765694 TGTTGAAGAGGCTGAGGCTGAGG + Intronic
1150471704 17:65442985-65443007 AGAGGAGGAAACCGAGGCTGAGG - Intergenic
1150808649 17:68338652-68338674 AGATGAAGAAACTGAGGCAGGGG - Intronic
1151715055 17:75827083-75827105 TGTGGAAATAACTGAGGCAGAGG - Intergenic
1151723323 17:75870572-75870594 AGAGGAAGAAACTGAGGCACAGG - Intergenic
1152310869 17:79549031-79549053 AGATGAAGAAACTGAGGCTCGGG + Intergenic
1152344440 17:79742692-79742714 AGATGAGGAAACTGAGGCTGGGG - Intergenic
1152636273 17:81431731-81431753 AGCTGAGGAAACTGAGGCTGAGG + Intronic
1152821255 17:82439022-82439044 AGCTGAAGAAACTGAGGCACGGG + Intronic
1153472483 18:5462621-5462643 TGGGGAAGAACCCGAGGGTGGGG + Intronic
1156215801 18:34996974-34996996 AGGTGAAGAAACTGAGGCTCAGG - Intronic
1158290645 18:55937855-55937877 AGAGGAAGAAACTGAGACTCAGG + Intergenic
1158429397 18:57370958-57370980 AGATGAAGAAACTGAGGCTTGGG + Intronic
1158927109 18:62277991-62278013 AGATGAAGAAACTGAGGCTTCGG - Intronic
1159533944 18:69691545-69691567 TGGGGAAGAACCTGAGTTTGGGG + Intronic
1160718279 19:586214-586236 AGCGGAGGAAACAGAGGCTTAGG - Intergenic
1160861105 19:1237553-1237575 ACAGGGAGAAACTGAGGCTGGGG + Intronic
1160904768 19:1446905-1446927 TGGAGGGGAAACTGAGGCTGGGG + Intronic
1161398223 19:4055969-4055991 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161398249 19:4056121-4056143 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161630370 19:5351917-5351939 AGTGGAAGAAACTGAGGCTTGGG + Intergenic
1161667662 19:5586787-5586809 ATGGGATGAAACTGAGGCTGGGG - Intergenic
1161714595 19:5868154-5868176 TGGGGGAGAGGCTGAGGCTGGGG + Intronic
1162004107 19:7766287-7766309 AGGGGAGGAAACTGAGGCTCAGG - Intronic
1162049958 19:8027055-8027077 AGAGGAAGGAACTGAGGCTGGGG + Intronic
1162190988 19:8946656-8946678 TGTGGAAGAAACAGAAGGTGAGG + Exonic
1162415316 19:10532769-10532791 AGGGGAAGAAACTGATTCTGGGG - Intergenic
1162535906 19:11262614-11262636 GGCTGGGGAAACTGAGGCTGGGG + Intergenic
1162535942 19:11262719-11262741 GGCTGGGGAAACTGAGGCTGAGG + Intergenic
1162535975 19:11262834-11262856 GGCTGGAGAAACTGAGCCTGAGG + Intergenic
1162954204 19:14089599-14089621 AGCGGAGGAAACTGAGGCTCCGG + Intronic
1162997388 19:14344846-14344868 TGATGAGGAAGCTGAGGCTGGGG - Intergenic
1163123107 19:15230019-15230041 GCTGGAGGAAACTGAGGCTGGGG - Intronic
1163255329 19:16152736-16152758 AGCAGCAGTAACTGAGGCTGTGG + Intronic
1163451062 19:17377675-17377697 GGCGGAGGAAACTGAGGCACAGG + Intergenic
1163480786 19:17555280-17555302 AGCAGAGGAAACTGAGGCTAAGG + Intergenic
1163524137 19:17810135-17810157 TGTAGGGGAAACTGAGGCTGAGG + Intronic
1163848652 19:19651367-19651389 TGAGGATGACACTGAGGATGGGG + Intronic
1163910160 19:20182423-20182445 TGCAGAACAAACAGAAGCTGTGG - Intronic
1164246014 19:23429665-23429687 TGTGGAAGAAACTGAAAGTGGGG + Intergenic
1164712969 19:30372122-30372144 AGCTGACAAAACTGAGGCTGAGG + Intronic
1164741195 19:30576652-30576674 TGCAGAGGAAAGTGAGGCAGGGG - Intronic
1165732062 19:38152310-38152332 AGCTAAGGAAACTGAGGCTGTGG + Intronic
1165785968 19:38462195-38462217 GGAGGAACAAACTGAGGCTCAGG - Intronic
1165949651 19:39466900-39466922 AGCAGAAGAAACTGAGGCACAGG - Intronic
1166129202 19:40735942-40735964 AGATGAGGAAACTGAGGCTGAGG + Intronic
1166811371 19:45516430-45516452 TCAGGAAGAAGCTGAGGCTTGGG - Intronic
1166853673 19:45771877-45771899 TGCGGCAGAGGCTGAGGCCGAGG - Exonic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167243742 19:48361111-48361133 AGTGGGAGAAACTGAGGCTCTGG + Intronic
924963836 2:57822-57844 AGTGGGAGAAGCTGAGGCTGGGG + Intergenic
926120395 2:10238480-10238502 TGGGTAAGAAATTGAGGCTCAGG + Intergenic
926692893 2:15749343-15749365 GGATGAAGAAACTGAGGCCGAGG + Intergenic
927154866 2:20215705-20215727 AGATGAGGAAACTGAGGCTGGGG + Intronic
927184899 2:20475055-20475077 TGGGCAAGAGGCTGAGGCTGGGG + Intergenic
927286717 2:21364301-21364323 TACGCAAGAAACTGTGGCTTGGG + Intergenic
927329633 2:21846916-21846938 TTAGGAAGAAACTGAGAGTGAGG + Intergenic
927481971 2:23461204-23461226 AGCTGAAGAGACTGAGGCAGAGG + Intronic
927706946 2:25302288-25302310 TGAGAAAGATACTGAGGATGAGG + Intronic
927988913 2:27433380-27433402 TGGGGAAGCAGCTGAGGTTGTGG - Exonic
928102522 2:28447538-28447560 TGATGAGGAAACTGAGGCTTTGG + Intergenic
928399856 2:30969969-30969991 AGATGAAGAAACTGAGGCTTGGG - Intronic
928450666 2:31375430-31375452 TGAAGAAGAAGCTGAGGGTGAGG + Exonic
928922628 2:36541429-36541451 TACAGAAGAAACTGAGGCTCAGG + Intronic
929234628 2:39593052-39593074 AGAAGAAGAAACTGAGGCTTGGG - Intergenic
929552805 2:42905144-42905166 TGCTGAGGCAACTGAGGCTCAGG + Intergenic
929581403 2:43083763-43083785 TCCTGAAGAAACTGAGGCTTGGG + Intergenic
930176450 2:48306032-48306054 GGGGAAAGAAACTGTGGCTGTGG - Intergenic
930474100 2:51857334-51857356 AGCTGAAGAAACTGAGTCTCAGG + Intergenic
931323077 2:61191561-61191583 TGAGCAAGAAACAGAGGCAGAGG - Intronic
931357453 2:61549591-61549613 GGCGCATGAAGCTGAGGCTGAGG + Intergenic
932682380 2:73836851-73836873 TGGGGAAGAAATGGAGGCTTAGG + Intronic
933302768 2:80561241-80561263 TGCCGAAGTAACTTAGACTGTGG - Intronic
934116934 2:88807564-88807586 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
934498272 2:94830909-94830931 TAGGGAAGAAATTGAGGCTAGGG - Intergenic
934557372 2:95294584-95294606 GTGGGGAGAAACTGAGGCTGGGG - Intergenic
936160432 2:110080516-110080538 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
936184232 2:110290838-110290860 TGAGGTTGCAACTGAGGCTGTGG + Intergenic
936440554 2:112548316-112548338 AGCAGAGGAAACTGAGGCTCAGG - Intronic
936785003 2:116084387-116084409 TGAAGAAGAAACTGAGGCTTTGG + Intergenic
936912622 2:117608507-117608529 TACAGATGAAATTGAGGCTGAGG - Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937680722 2:124641262-124641284 AGAGGAGGAGACTGAGGCTGGGG + Intronic
939884967 2:147671557-147671579 AGAGGAAGAAACTGAGTCTCGGG + Intergenic
940371492 2:152906214-152906236 TGTGGACGTAACTAAGGCTGAGG + Intergenic
941588140 2:167385061-167385083 AGAGGAAGAAATTGAGGCTTGGG + Intergenic
941843427 2:170111172-170111194 AGAGGAGGAAACTGAGGCTCAGG + Intergenic
941914788 2:170804258-170804280 TTAGGAAGAAGCTGATGCTGTGG + Intergenic
942306401 2:174611544-174611566 AGAGGCAGAAGCTGAGGCTGGGG - Intronic
942862260 2:180629089-180629111 TGTGGAAGAGAATGAGGTTGAGG - Intergenic
943033100 2:182709065-182709087 AGAGGAGGAAACTGAGGCTCAGG - Intergenic
943365827 2:186966840-186966862 TACAGAATAAACTGAGGCTCAGG - Intergenic
943627413 2:190215964-190215986 AGAGGAAGAAACTGAGTTTGAGG + Intronic
944210878 2:197205482-197205504 TGAGAAAGAAACTGGGGCTTGGG + Intronic
944679406 2:202063245-202063267 AGTGGAGGAAACTGAGGCTCAGG + Intergenic
944691338 2:202161101-202161123 AGTTGAAGAAACTGAGGCTCAGG + Intronic
945497775 2:210530598-210530620 AGATGAAGAAGCTGAGGCTGAGG + Intronic
945616251 2:212071990-212072012 AGAAGAAGAAACTGAGGCTCAGG + Intronic
945951087 2:216039568-216039590 AGAGGAGGAAACTGAGGCTCAGG - Intronic
946157910 2:217818924-217818946 AGAAGAAGAAACTGAGGCTCAGG + Intronic
946307967 2:218866647-218866669 AGTTGAAGAAACTGAGGCTCAGG + Intronic
946421579 2:219568019-219568041 TGGGGAAGAGGCTGAGGCGGAGG - Intronic
947448204 2:230180770-230180792 GGGAGAAGAAACTGATGCTGAGG + Intronic
947844106 2:233230303-233230325 AGAGGAAGAAACTGAGGTTCAGG + Intronic
947845222 2:233238267-233238289 AGAGGAAGAAAGTGAGGCTCAGG - Intronic
947963591 2:234260175-234260197 TGAGGCTGAGACTGAGGCTGAGG - Intergenic
948192418 2:236070165-236070187 AGAGGAGGAAACTGAGTCTGGGG - Intronic
948498089 2:238367713-238367735 TGCTGAGGAAATTGAGGCTTAGG + Intronic
948593896 2:239067546-239067568 TGAGGAGGAAGCTGAGGATGTGG + Intronic
948671428 2:239571122-239571144 AGAGGAGGAAACCGAGGCTGGGG - Intergenic
948757439 2:240167672-240167694 TGAGGAACACACTGGGGCTGAGG + Intergenic
948808380 2:240462709-240462731 TGCAGGAGGGACTGAGGCTGTGG - Intronic
1168887205 20:1267860-1267882 AGATGGAGAAACTGAGGCTGGGG - Intronic
1169793337 20:9435193-9435215 AGATAAAGAAACTGAGGCTGGGG + Intronic
1170055416 20:12197551-12197573 AGAGGAAGAAACTGAGGCACAGG - Intergenic
1170967804 20:21091475-21091497 TCAGTAAGAAACTAAGGCTGTGG - Intergenic
1172193302 20:33075248-33075270 TGATGAAGAAACTGAGGCTCAGG - Intergenic
1172634431 20:36400646-36400668 TGATGGGGAAACTGAGGCTGGGG + Intronic
1172897201 20:38308649-38308671 AGATGAGGAAACTGAGGCTGGGG + Intronic
1172943608 20:38671544-38671566 GGATGAAGAAACTGAGGCTCGGG - Intergenic
1173552769 20:43944836-43944858 AGGTGAAGAAACTGAGGCTCAGG + Intronic
1173562286 20:44014607-44014629 AGATGAAGAAACTGAGGCTCAGG - Intronic
1173850308 20:46213537-46213559 AGAGGAGGAAACTGAGGCTCAGG - Intronic
1173968541 20:47132539-47132561 AGCTGAAGAAACTGAGGCCCAGG + Intronic
1174180421 20:48670883-48670905 TGATGAAGAAACTGAGGCTTGGG - Intronic
1174487215 20:50869098-50869120 AGAGGAAGAAAGTGAGGCAGAGG + Intronic
1174500692 20:50981963-50981985 AGATGAAGAAACTGAGGCAGAGG + Intergenic
1174836133 20:53856765-53856787 AGAGGAAGAAATTGAGGCTCAGG + Intergenic
1175105364 20:56611085-56611107 AGACGAAGAAACTGAGGCTCAGG - Intergenic
1175259427 20:57665228-57665250 AGATGAAGAAACTGAGGCTTAGG + Intronic
1175273026 20:57748302-57748324 TGATGAGGAAACTGAGGCCGGGG - Intergenic
1175422649 20:58844556-58844578 TTTAGAAGAAACTGAGGCAGAGG - Intronic
1175681120 20:60989693-60989715 AGATGAAGAAACTGAGGCTTAGG + Intergenic
1176298824 21:5088854-5088876 TGCTGCAGAAACGGAGGCAGAGG - Intergenic
1177562608 21:22775895-22775917 TGCTTCAGAAACTGTGGCTGAGG - Intergenic
1178128939 21:29547500-29547522 AGATGAAGAAACTGAGGTTGAGG + Intronic
1179321951 21:40300666-40300688 ATCGGAGGAAACTGAGGCAGAGG - Intronic
1179515549 21:41903894-41903916 AGGGGAAGAAACTGAGGAAGGGG + Intronic
1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG + Intergenic
1181164730 22:20977183-20977205 TGTGGTGGAAACTGAGGCTCTGG - Intronic
1181564682 22:23728217-23728239 TGCAGCAGAAACAGATGCTGGGG - Intergenic
1181786081 22:25228164-25228186 AGATGAAGAAACTGAGGCTCAGG - Intronic
1181808248 22:25388155-25388177 AGATGAAGAAACTGAGGCTGGGG - Intronic
1181818256 22:25455994-25456016 AGATGAAGAAACTGAGGCTCAGG - Intergenic
1182097891 22:27638282-27638304 AGCAGAGGAAACTGAGGCTCAGG - Intergenic
1182104827 22:27681824-27681846 TGGGGTAGAAAGTGAGGGTGGGG + Intergenic
1182352275 22:29705646-29705668 AGAGGAGGAAACTGAGGCTCAGG + Intergenic
1182676331 22:32042581-32042603 AGAGGAAGAAACTGAGACTGGGG - Intergenic
1182715913 22:32356190-32356212 GGCTAAAGAAACAGAGGCTGTGG + Intronic
1183118757 22:35713365-35713387 AGCGAAAGAAACAGATGCTGGGG + Intergenic
1183262000 22:36801326-36801348 AGATGAAGAAACTGAGGCTCAGG + Intronic
1183340255 22:37276319-37276341 AGATGAAGAAACTGAGGCTCAGG + Intergenic
1183647746 22:39136244-39136266 TGAGAAAGAAACTGAGGCCCAGG - Intronic
1183692815 22:39400475-39400497 GGAGAAGGAAACTGAGGCTGAGG - Intronic
1183769091 22:39908071-39908093 TAAGGAAGAAACTGAAGCTCAGG - Intronic
1183832409 22:40425342-40425364 TACAGAAGGAACTGAGGCAGTGG + Intronic
1184105594 22:42365827-42365849 TGCGGAAGGGGCTGAGGGTGGGG + Intergenic
1184408987 22:44315874-44315896 TGCGGAATCACCTGAGGCCGGGG - Intergenic
1184458785 22:44625718-44625740 AGAGGAGGAAACTGAGGCTCAGG - Intergenic
1184679177 22:46061341-46061363 TGCCGGGGAAACTGAGGCTCCGG - Intronic
1184884123 22:47331897-47331919 TGCGGGAAAAGCTGATGCTGTGG + Intergenic
1185053626 22:48566645-48566667 TGCTGAGGAAACTAAGGCTGAGG - Intronic
1185266471 22:49906781-49906803 TGCGGAAGAACCCAGGGCTGAGG - Intronic
949273197 3:2245239-2245261 TAGGGATGAAACTGAGGCTAGGG + Intronic
949506113 3:4729227-4729249 AGCAGAAGAAACTGAGGCACAGG - Intronic
949824319 3:8149092-8149114 TGCAGAAGAAATTGATGGTGAGG - Intergenic
949881111 3:8661660-8661682 TCCTGTGGAAACTGAGGCTGAGG - Intronic
949982393 3:9509897-9509919 GGATGAAGAAACTGAGGCTGAGG + Intronic
950215417 3:11155013-11155035 AGAGGAGGAAACTGAGGCTCGGG + Intronic
950412990 3:12851067-12851089 CAAGGAAGAAACTGAGGCTCAGG - Intronic
950461397 3:13124386-13124408 AGATGAAGAAACTGAGGCTGGGG - Intergenic
950471476 3:13189247-13189269 TGCAGAAGAAACTGGGTCAGAGG - Intergenic
950499575 3:13355078-13355100 AGCTGGAGAAACTGAGGCTCAGG - Intronic
950625882 3:14246472-14246494 TGAGCAAGTAAGTGAGGCTGGGG + Intergenic
951678776 3:25272862-25272884 AGGGGAAGATACTGAGGCTCAGG - Intronic
951786171 3:26421636-26421658 TTGGGAAGAAACTGAAGGTGGGG + Intergenic
952277945 3:31895499-31895521 TGGGGATGAAACTCAGGCAGTGG + Intronic
953517702 3:43612401-43612423 TGGGAAGGAAGCTGAGGCTGGGG - Intronic
953666095 3:44927663-44927685 TCAGGAAAAAACTGGGGCTGGGG + Intronic
953691912 3:45126859-45126881 AGATGAAGAAACTGAGGCTTGGG + Intronic
953911761 3:46896747-46896769 TGTGGAAGATACAGAGGCTGGGG + Intronic
953988155 3:47461575-47461597 TAAGGAAGAAACTGAGGCTTAGG + Intronic
954525867 3:51270791-51270813 TGCAGAAGCAAATGAAGCTGTGG - Intronic
954617251 3:51975296-51975318 CGCGGAAGAAGCAGACGCTGGGG + Intronic
954717002 3:52531894-52531916 GGAGGAAGAAACTGGGGCTCAGG + Intronic
954841363 3:53514696-53514718 AGATGAAGAAACTGAGGCTTGGG + Intronic
955190890 3:56760628-56760650 TGAGGAGGAAACTGAGGTTGAGG + Intronic
955971253 3:64440780-64440802 TGGTGAGAAAACTGAGGCTGAGG - Intronic
958436046 3:94096793-94096815 TAATTAAGAAACTGAGGCTGGGG - Intronic
958452217 3:94287764-94287786 TGAGGAAGTAACTGAAGCTGTGG + Intergenic
958835852 3:99144017-99144039 AGAGAAAGAAACTGAGGCTGAGG - Intergenic
959634675 3:108551871-108551893 AACTGAAGAAACTGAGTCTGAGG - Intronic
960022144 3:112966852-112966874 TGGGAAGGAAATTGAGGCTGTGG - Intronic
960323398 3:116265199-116265221 TGCTGAAGAATATGAAGCTGTGG + Intronic
962706188 3:138046982-138047004 AGCTGAGGAAACTGAGGCTTGGG + Intergenic
963344908 3:144083826-144083848 TGAGAAAGAAAATGAGGCTTAGG + Intergenic
964736284 3:159922017-159922039 TGCGGAAGAAACTCAAGATAAGG - Intergenic
965354783 3:167660297-167660319 AGCTGAAGAAACTGAGGCTTAGG + Intergenic
965675220 3:171187739-171187761 AGATGAAGAAACTGAGGCCGAGG - Intronic
966377236 3:179308850-179308872 TGAGGAACAAACTCAGACTGAGG - Intergenic
966592761 3:181699933-181699955 TGGGGAAGAAAGTGAGGTGGGGG - Intergenic
966807745 3:183819768-183819790 TTCAGAAGAAACTGAGGCTCAGG - Intronic
966993025 3:185253687-185253709 TGATAAGGAAACTGAGGCTGAGG - Intronic
968577983 4:1376802-1376824 TGCGGCAGGAGCTGAGGCGGCGG - Intronic
968585298 4:1413598-1413620 AGAGGGAGAAACTGAGGCAGAGG - Intergenic
968742987 4:2340691-2340713 GGAGGTGGAAACTGAGGCTGGGG + Intronic
968938310 4:3624888-3624910 AGAGGAAGAAGCTGAGCCTGGGG + Intergenic
969165635 4:5308442-5308464 TAAGGAAGAAACTGAGGCATCGG - Intronic
969329338 4:6464084-6464106 AGAGGAGAAAACTGAGGCTGAGG - Intronic
969693770 4:8723657-8723679 AGGAGCAGAAACTGAGGCTGGGG + Intergenic
969857680 4:10013502-10013524 AGGCGAGGAAACTGAGGCTGAGG - Intronic
969929781 4:10619818-10619840 AGATGAAGAAACTGAGGCTAAGG + Intronic
969929897 4:10620778-10620800 AGATGAAGAAGCTGAGGCTGAGG + Intronic
972016635 4:34254519-34254541 AGTGGAAAAAACTGAGGCTTCGG + Intergenic
972909035 4:43790774-43790796 AGATGAAGAAACTGAGGCTCAGG + Intergenic
975404085 4:73969135-73969157 TGGGGAAGAAACTGAGCCTGAGG + Intergenic
975622749 4:76310037-76310059 TGTGGAAGAGGCTGAGGTTGTGG + Exonic
977516618 4:98028158-98028180 TGGGGAGAAAACTGAGGTTGTGG - Intronic
978303065 4:107292900-107292922 TGAGGAAGAAACTTAGGCTTTGG + Intergenic
979939075 4:126737374-126737396 TGAGGAATAAACCCAGGCTGGGG + Intergenic
981088947 4:140712838-140712860 TCCGGAACAAACTGAGGGTCGGG + Intronic
981151708 4:141386400-141386422 GGCTGAAGAAACTGAGGCCTAGG - Intergenic
981963324 4:150569001-150569023 TGATGAAGAAACTGAGGCATGGG - Intronic
982172393 4:152674670-152674692 TTTGGAAGAAACTGAGACAGGGG - Intronic
984065869 4:175047581-175047603 AGCTGAAGACACTGAGGCTTAGG - Intergenic
984367385 4:178816695-178816717 TGCAGAAAAAAATAAGGCTGTGG - Intergenic
984972026 4:185200185-185200207 TGGGGAAGGAACTGCAGCTGTGG + Intronic
985074887 4:186204541-186204563 AGAGGCAGAAACTGAGCCTGCGG - Intronic
985676687 5:1235065-1235087 TTGGGGAGAAAGTGAGGCTGTGG - Intronic
985770559 5:1807585-1807607 TGGGGAAGCAAGTGAGGCTGAGG + Intronic
986387356 5:7247752-7247774 TGAGGAAGACAATGAGCCTGGGG + Intergenic
986437823 5:7751844-7751866 TGATAAAGGAACTGAGGCTGTGG - Intronic
987203404 5:15600352-15600374 TGGGGAAGAAAGTGAGGGAGGGG + Intronic
987401878 5:17486414-17486436 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987403124 5:17498412-17498434 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405305 5:17518548-17518570 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405750 5:17521982-17522004 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987406197 5:17525416-17525438 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987407502 5:17585555-17585577 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408200 5:17590757-17590779 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408648 5:17594191-17594213 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987409104 5:17597625-17597647 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987412893 5:17632269-17632291 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987413167 5:17634641-17634663 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
988687292 5:33537465-33537487 TTGGCAAGAAACTGAGGCTGAGG + Intronic
988793159 5:34627643-34627665 AGACGAAGAAACTGAGGCTTTGG - Intergenic
988821548 5:34890967-34890989 TGATGAATAAACAGAGGCTGAGG - Intronic
989111447 5:37910206-37910228 TGAAAAAGAAACTGAGGCAGAGG + Intergenic
989113281 5:37927807-37927829 TGAAAAAGAAACTGAGGCAGAGG + Intergenic
989702098 5:44280892-44280914 TATGGAAGAAACTTAGGGTGAGG + Intergenic
990889545 5:60633115-60633137 TTCTGAAGAATCTGAGGCTAGGG + Intronic
992401846 5:76418827-76418849 TGTGGAAGATAGTGTGGCTGGGG + Intronic
992431717 5:76716479-76716501 TTCGGAGGAAACTGAGGCAGGGG - Intronic
993377313 5:87164278-87164300 AGTGGAAGAAACTGAGACTCAGG + Intergenic
996316157 5:122163059-122163081 TATGGTAGAAACTGAGGCTTGGG - Intronic
997744596 5:136288120-136288142 AAAGGAAGAAACTGAGGCAGAGG + Intronic
998182597 5:139955906-139955928 AGAGGAAGAAGCTGAGGGTGAGG - Intronic
998785765 5:145707179-145707201 TGGTGAAGAAGCTGAGGCTCAGG + Intronic
998998290 5:147891160-147891182 AGGTGAAGAAACTGAGGCTCAGG - Intronic
999300516 5:150487169-150487191 AGGTGAAGAAACTGAGGCTAGGG - Intronic
999450567 5:151674620-151674642 GGTGGAAGAAACTGTGGCAGAGG - Exonic
999500899 5:152145539-152145561 TGCTGTTGAAACTGAGGCAGTGG + Intergenic
1000285965 5:159826417-159826439 TGATGAAGAAACTGAGGCCCAGG - Intergenic
1000982472 5:167830795-167830817 TGAGTGAGAAACTGAGGTTGGGG - Intronic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001217118 5:169866312-169866334 TGTGGATGAAACATAGGCTGTGG + Intronic
1001428507 5:171641257-171641279 TGCTCAATAAACAGAGGCTGAGG + Intergenic
1001529462 5:172452174-172452196 AGATGAAAAAACTGAGGCTGAGG + Intronic
1001542524 5:172549631-172549653 AGAGGAGGAAACTGAGGCTCAGG - Intergenic
1001757325 5:174180678-174180700 AGATGAATAAACTGAGGCTGAGG + Intronic
1001781479 5:174372545-174372567 AACTGAAGAAACTGAGGCTCAGG - Intergenic
1001970433 5:175950990-175951012 TCCTGCAGAAACTGAGGCTCAGG - Intronic
1002247004 5:177892771-177892793 TCCTGCAGAAACTGAGGCTCAGG + Intergenic
1002334227 5:178466937-178466959 AGCTGGGGAAACTGAGGCTGTGG - Intronic
1002933315 6:1650048-1650070 AGCTGAAGAAACTGAGGCCGTGG - Intronic
1002972159 6:2034925-2034947 TGAGGAAGAAACCCAGCCTGAGG + Intronic
1003191908 6:3881692-3881714 TGCACAAGAAACTGGGGCTGGGG - Intergenic
1003459426 6:6316827-6316849 TGATGGAGAAACTGAGGCTTGGG + Intronic
1004628022 6:17394292-17394314 TGCAGAGGCAACTGAGACTGGGG + Intronic
1004638200 6:17488619-17488641 AGCAGAGGAAACTGAGGTTGAGG - Intronic
1005894933 6:30169980-30170002 TGAGGAAGAAACTGAGACCCAGG + Intronic
1006144783 6:31952197-31952219 TGCTGAAAAACCAGAGGCTGAGG + Exonic
1006293311 6:33157583-33157605 AGGTGAAGAAACTGATGCTGAGG + Intergenic
1006437672 6:34034730-34034752 TGATGAAGAAACTGAGGCCAGGG + Intronic
1006449044 6:34095469-34095491 AGCTGAAGAAACTGAGGCCGGGG - Intronic
1007280790 6:40710726-40710748 GGCTGGAGAAACTGAGGGTGGGG + Intergenic
1007647448 6:43393916-43393938 AGAGGAAGAAACTGAGTATGAGG + Intergenic
1007680452 6:43629727-43629749 AGGGGAAGAAACTGAGGCAGAGG - Exonic
1007896674 6:45369176-45369198 TGTGGTAGAAAAGGAGGCTGGGG - Intronic
1012771891 6:103448714-103448736 TTAGGAAGTAAGTGAGGCTGTGG + Intergenic
1013020949 6:106217538-106217560 TGAGGAAGAAAGTGAAGATGAGG - Intronic
1014397748 6:120946909-120946931 GGAGGCAGAATCTGAGGCTGAGG + Intergenic
1014874853 6:126644438-126644460 TGATAAAGAAACTGAGGCTTAGG + Intergenic
1015503299 6:133954707-133954729 TGGGGAACAAACAGAAGCTGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016479124 6:144462701-144462723 TGCAGAAGAAACAAAGGCTCTGG + Exonic
1017721507 6:157246405-157246427 TGCGGGAGAAAGTGGGTCTGGGG - Intergenic
1018092073 6:160354282-160354304 TGCTGAGGAAACTGAGGCTCAGG - Intronic
1019190856 6:170249835-170249857 TAGTGAGGAAACTGAGGCTGAGG + Intergenic
1019357708 7:589556-589578 TATGGAAGAAACAGAGGCTCAGG + Intronic
1020086724 7:5314494-5314516 AGATGAGGAAACTGAGGCTGAGG - Intronic
1022053402 7:26702619-26702641 TCAGTAAGAAACTGAGGGTGGGG + Intronic
1022221474 7:28318176-28318198 TGTAGAAGAAACATAGGCTGTGG - Intronic
1022531585 7:31070192-31070214 TGCAGAAGGAACGGAGCCTGGGG - Intronic
1024045225 7:45581129-45581151 TGAGGGAGAAACTGAGGCATGGG - Intronic
1024479687 7:49851049-49851071 TCCAGAAGAAACTGACTCTGTGG - Intronic
1024551329 7:50564927-50564949 TACAGAAGAAACAGAGGCTGGGG + Intronic
1025207595 7:57002638-57002660 AGATGAGGAAACTGAGGCTGAGG + Intergenic
1025664343 7:63574232-63574254 AGATGAGGAAACTGAGGCTGAGG - Intergenic
1026852864 7:73735805-73735827 TGGAGGAGAAACTGAGGCTGAGG + Intergenic
1026859573 7:73777001-73777023 AGAGGAGGAAACTGAGGCTAAGG + Intergenic
1027008966 7:74725245-74725267 TGCAGAAAAAATTGAGGATGTGG + Intronic
1027139533 7:75647444-75647466 AGAGGATAAAACTGAGGCTGAGG - Intronic
1027162724 7:75814103-75814125 AGCTGAAGTAACTGAGGCTCAGG - Intronic
1029128884 7:98314811-98314833 TGGTGAAGACACTGATGCTGAGG + Intronic
1029570394 7:101364500-101364522 AGCTGAAGAAACAGAGGCTCAGG + Intronic
1029724297 7:102392065-102392087 TGTGACAGACACTGAGGCTGGGG + Intronic
1030096304 7:105903244-105903266 AAAGGAAGAAACTGAGGCTCAGG - Intronic
1030427727 7:109400685-109400707 TGGGTAAGAAATTGAGGCAGAGG + Intergenic
1030620203 7:111781335-111781357 TGTGGGAGAAACTCAGGCTGAGG + Intronic
1031317545 7:120274911-120274933 TGCGGTAGAAATTCAGGATGTGG - Exonic
1032679664 7:134168694-134168716 TGAGGAAGAAGATGTGGCTGAGG + Intronic
1033230406 7:139593244-139593266 AGATGAAGAAACTGAGGCTCAGG - Intronic
1033259073 7:139826634-139826656 AGAGGAAGAAACTGAGGCATGGG - Intronic
1034417440 7:150972449-150972471 GGCAGAAGAAGCGGAGGCTGAGG + Intronic
1034981713 7:155483278-155483300 GGAGGAAGAGACTGAGGCTCCGG - Intronic
1035403985 7:158586956-158586978 CGGGGAGGAAACTGAGGCAGGGG + Intronic
1036705531 8:11043511-11043533 TGGGGCAGAGACTGAGGCTCAGG - Intronic
1037499541 8:19471789-19471811 TGGGGAAGAAACAGATTCTGAGG + Intronic
1037663387 8:20945470-20945492 TAGGGAGGAAGCTGAGGCTGGGG - Intergenic
1038026198 8:23592905-23592927 TCTGGAGGAAGCTGAGGCTGGGG - Intergenic
1038045083 8:23759656-23759678 TACTGCAGAAACTGAGGCTCAGG - Intergenic
1038289611 8:26237162-26237184 TGCCAAGGAAACTGAGTCTGAGG - Intergenic
1038362915 8:26900909-26900931 TGCAGAAGCCACTCAGGCTGTGG - Intergenic
1039488613 8:37930789-37930811 TGAAGAAGAACCTGAGACTGTGG + Intergenic
1039848771 8:41344575-41344597 AGAGGAAGAAAGTGAGGCAGGGG - Intergenic
1039950143 8:42164525-42164547 TGCCGAAGACACTGAGGAAGAGG + Intronic
1042130121 8:65579722-65579744 TGCGAGAGAAACACAGGCTGTGG - Intergenic
1042303265 8:67308597-67308619 TGGGCAAGAGGCTGAGGCTGTGG - Intronic
1042682509 8:71401642-71401664 TGATGAAGAAACTGAGGCAATGG - Intergenic
1043186020 8:77150899-77150921 TGGGTAAGAAAATGAGGCTGAGG - Intergenic
1044698529 8:94947063-94947085 TGATGAGGAAACCGAGGCTGAGG + Intronic
1047302119 8:123622462-123622484 TCAGGAAGAAACTTAGGCTCTGG - Intergenic
1047335433 8:123931275-123931297 CGTGGAAGAAGCTCAGGCTGGGG - Intronic
1048019485 8:130525351-130525373 AGAGGAGGAAACTGAGGCTTAGG + Intergenic
1048031826 8:130640430-130640452 AGGTGAAGAAACTGAGGCTCAGG + Intergenic
1048050212 8:130809307-130809329 AGATGAAGAAACTGAGGCTCAGG - Intronic
1048264336 8:132972252-132972274 TGAGGAGGAAACAGAGGCTCAGG - Intronic
1048867715 8:138773002-138773024 AGCTGCAGACACTGAGGCTGGGG + Intronic
1049038364 8:140094306-140094328 TGCAGAAGAAACTCATGCTTGGG + Intronic
1049195649 8:141314255-141314277 TGATGAGGAAACTGAGGCTCAGG - Intergenic
1049202700 8:141349716-141349738 AGAGGAGGAAACTGAGGCTTAGG + Intergenic
1049674992 8:143885396-143885418 AGAGGAAAACACTGAGGCTGTGG - Intergenic
1050162538 9:2733266-2733288 TGAAGCAGAAACTGAGGCTGAGG - Intronic
1051080600 9:13289134-13289156 TGGGGAAGAAACTAGGGCAGAGG + Intergenic
1053351280 9:37414884-37414906 AGACGAAGAAACTGAGGCTCAGG - Intergenic
1053351703 9:37417579-37417601 GGCTGAAGAAACTGAAGCTTAGG - Intergenic
1054452892 9:65412871-65412893 AGAGGAAGAAGCTGAGCCTGGGG - Intergenic
1055235531 9:74118167-74118189 TGGGGAACCAACTGAGACTGGGG + Intergenic
1057183124 9:93040433-93040455 TGGGGAGAAAACTGAGGTTGGGG + Intergenic
1057748536 9:97771623-97771645 AGATAAAGAAACTGAGGCTGAGG - Intergenic
1057849412 9:98553241-98553263 TGTGGGAGAAACTGAGTCTCAGG + Intronic
1057900592 9:98944838-98944860 TGCTGGAGAAACTGAGGCCCGGG - Intronic
1059343461 9:113612737-113612759 AGAGGAAGAAACTGAGGCTCAGG + Intergenic
1059663033 9:116420234-116420256 TGCAGAAGAAGCTGAGACTTAGG + Intergenic
1059798553 9:117726709-117726731 AGAGGAGGAAACTGAGGCTAAGG + Intergenic
1060405636 9:123371670-123371692 TGATGAGGAAACTGAGGCTCAGG + Intronic
1060666530 9:125435368-125435390 AGAAGAAGAAACTGAGGCTCAGG + Intergenic
1060992920 9:127858951-127858973 GATGGAAGAAACTGAGGCTCAGG + Intergenic
1061384696 9:130282358-130282380 AGATGAAGAAACTGAGGCTTGGG + Intergenic
1061533580 9:131233524-131233546 CGGGGAAGAAGCTGAGGATGCGG - Exonic
1061731148 9:132615021-132615043 TGCAGAAGGAACAGGGGCTGTGG + Intronic
1061912284 9:133731571-133731593 TCTGGGAGAAAGTGAGGCTGGGG - Intronic
1062002864 9:134225582-134225604 AGGTGAGGAAACTGAGGCTGGGG - Intergenic
1062051256 9:134448231-134448253 AGGGGCAGAAACTGAGGCTCTGG - Intergenic
1062444386 9:136587587-136587609 AGAGGAGGGAACTGAGGCTGGGG - Intergenic
1185728472 X:2442260-2442282 TGCTGAAGAAGCTGAGGAGGAGG + Intronic
1186930949 X:14389419-14389441 TGATGAAGAAACCGAGGCTAAGG + Intergenic
1186986553 X:15020928-15020950 TGAGGAAGAAATTGAGGATGTGG - Intergenic
1187238759 X:17493674-17493696 TCCAGAAGATACTGATGCTGTGG - Intronic
1188313003 X:28640696-28640718 TGATGAAGAAACTGAGCCTCAGG + Intronic
1189994088 X:46622567-46622589 AGCGGAAGAAACTGACTTTGGGG - Intronic
1191722168 X:64240946-64240968 TGAGGAAGAAAGAGAGGGTGGGG - Intergenic
1192173183 X:68869494-68869516 AGAGGAAGAAACTGAGACTTAGG + Intergenic
1192245512 X:69368515-69368537 AGTTGAAGAAACTGAGGCTTGGG - Intergenic
1192611057 X:72567607-72567629 TGATGAAGAAACTGAGGCCTAGG + Intronic
1192827113 X:74708912-74708934 TGTGGAATGGACTGAGGCTGAGG - Intergenic
1193425513 X:81337200-81337222 TGAAGAAGAAACAGAGCCTGAGG - Intergenic
1195318574 X:103702283-103702305 AGAGGAGGAAACTGAGACTGAGG + Intergenic
1196059366 X:111390887-111390909 TACTCAAGAAGCTGAGGCTGAGG + Intronic
1196725287 X:118889886-118889908 TGAGGATGAGGCTGAGGCTGAGG + Intergenic
1198662606 X:138986440-138986462 AGTGGAAGAAATTCAGGCTGGGG - Intronic
1198764745 X:140069067-140069089 AGAGGAAGAAACTGAGTCTTTGG + Intergenic
1198801112 X:140448644-140448666 TGCAGGAGAAACTGAGGCCATGG - Intergenic